ID: 1009174267

View in Genome Browser
Species Human (GRCh38)
Location 6:60440320-60440342
Sequence ATGTTGTTATAATTGGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009174263_1009174267 8 Left 1009174263 6:60440289-60440311 CCTTGATGACAGCATGCTTAAGG 0: 3
1: 0
2: 0
3: 6
4: 143
Right 1009174267 6:60440320-60440342 ATGTTGTTATAATTGGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009174267 Original CRISPR ATGTTGTTATAATTGGGTCA AGG Intergenic
No off target data available for this crispr