ID: 1009174502

View in Genome Browser
Species Human (GRCh38)
Location 6:60443220-60443242
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 3, 1: 0, 2: 0, 3: 11, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009174502_1009174503 28 Left 1009174502 6:60443220-60443242 CCTTATGGATTATGCTGATATAT 0: 3
1: 0
2: 0
3: 11
4: 157
Right 1009174503 6:60443271-60443293 ATTTTATTCAACATTTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009174502 Original CRISPR ATATATCAGCATAATCCATA AGG (reversed) Intergenic
901715248 1:11148466-11148488 CCTTATCAGCATAATCAATAGGG - Intronic
902539917 1:17147121-17147143 AGATAACAGCATAATGGATATGG + Intergenic
904766811 1:32855674-32855696 ACATATCACCATAATACCTATGG + Intronic
907666158 1:56435490-56435512 ATCTAGCAGCATGATACATAAGG + Intergenic
908593793 1:65663115-65663137 ATGTAACATCATAATCAATAGGG - Intergenic
909272300 1:73638778-73638800 ATATATGAGCACAATACTTATGG + Intergenic
910312539 1:85841006-85841028 ATATTTTAGCATAATATATAGGG - Intronic
911799315 1:102114323-102114345 TTATTTCAGCATATTCCAAATGG + Intergenic
911892241 1:103386178-103386200 ATATATCAGAAAAATTCTTAGGG - Intergenic
919004309 1:191875111-191875133 ATTTTTCAGCCTAATACATAAGG + Intergenic
919264526 1:195244627-195244649 ATATATCAGAATAATAAATATGG + Intergenic
919416013 1:197310697-197310719 ATATATTAGCATATTCTATCTGG + Intronic
923346512 1:233058542-233058564 ATATATCAGCATCACACATAGGG + Intronic
1063312380 10:4965970-4965992 ATAAATGAGCAGAATCAATATGG - Exonic
1063325455 10:5096466-5096488 ATAAATGAGCAGAATCTATATGG - Exonic
1063328645 10:5132691-5132713 ATAAATGAGCAGAATCAATATGG + Intronic
1063334717 10:5200237-5200259 ATAAATAAGCAGAATCAATATGG - Exonic
1063349890 10:5344330-5344352 ATAGATTGGCATAATCCATGGGG + Intergenic
1067181313 10:43988067-43988089 ATTTATTTCCATAATCCATAAGG - Intergenic
1067792762 10:49300340-49300362 CTATATCAGCAGAAACCATATGG + Intronic
1068139888 10:52992363-52992385 ACCTATCAGCATACTCAATATGG - Intergenic
1068824327 10:61417330-61417352 GTATATCAGCACACTCAATATGG + Intronic
1073405703 10:103295460-103295482 AAATATCAGCATAAAACATAGGG - Intergenic
1079741163 11:24062730-24062752 ATAAATCAGCATCTTACATAAGG + Intergenic
1080504501 11:32899154-32899176 ATATAACAGCAAAACACATAGGG - Intronic
1082153936 11:48779075-48779097 CTATTTCACCATAGTCCATAAGG + Intergenic
1085244263 11:75086298-75086320 ATCAAACAGCATAATCCATAAGG + Intergenic
1087270203 11:96103452-96103474 AAATATCAGCAAATCCCATATGG + Intronic
1087677622 11:101181052-101181074 AAATAACAGCATAATCAATCTGG + Intergenic
1090604503 11:128407347-128407369 ATATATGAGCATAATCAGCAAGG + Intergenic
1090737815 11:129626258-129626280 ATATACCAGTATAATCAATTTGG - Intergenic
1099628549 12:85109729-85109751 ATATATCAGAATCATCAAAAGGG - Intronic
1109023177 13:57125238-57125260 ATATATTAACCTAATACATAAGG + Intergenic
1109107958 13:58278423-58278445 ATGTATCATTATATTCCATAAGG - Intergenic
1109356634 13:61238066-61238088 ATATATCAGCAAAAAACAGAAGG + Intergenic
1111033500 13:82638411-82638433 ATATAGCAGCATAATATATGTGG + Intergenic
1112976753 13:105329343-105329365 ATTTATAAGCAGAATGCATAAGG + Intergenic
1115187955 14:30713662-30713684 ATATATAATGATAAACCATAAGG - Intronic
1115407140 14:33029874-33029896 ATAAATTGGCATAATCCATTTGG - Intronic
1115814491 14:37148146-37148168 ACATATAAGCAAAATACATAAGG - Intronic
1116886469 14:50226827-50226849 ATAAATCAGCATTCTTCATATGG - Intronic
1117868999 14:60178163-60178185 AAATATCAGCAATATCCCTATGG + Intergenic
1121190033 14:92019053-92019075 ATATATTGGGATAATACATATGG + Intronic
1125790288 15:42360296-42360318 AAATCTCAGCAAAATCCAGAGGG + Intronic
1126515800 15:49536447-49536469 ATGTATCAGAAGAATCAATATGG + Intronic
1130263852 15:82380905-82380927 ATATTTTAGCATAAGCCGTAGGG + Intergenic
1130277444 15:82488748-82488770 ATATTTTAGCATAAGCCCTAGGG - Intergenic
1130469764 15:84215938-84215960 ATATTTTAGCATAAGCCCTAGGG - Intergenic
1130477252 15:84330500-84330522 ATATTTTAGCATAAGCCCTAGGG - Intergenic
1130494513 15:84457630-84457652 ATATTTTAGCATAAGCCCTAGGG + Intergenic
1130592053 15:85220561-85220583 ATATTTTAGCATAAGCCCTAGGG - Intergenic
1131822800 15:96290302-96290324 ATATATTAGCAAAATCCTTTTGG - Intergenic
1134818894 16:17229492-17229514 AGATCCCAGCATAAGCCATAAGG - Intronic
1138040711 16:53662256-53662278 ATAATTCAGCATAATGCATATGG - Intronic
1138923133 16:61556932-61556954 ATATATGAACATACTCCACATGG + Intergenic
1150943937 17:69724009-69724031 CTATATCAGAAAAACCCATATGG + Intergenic
1151041751 17:70869855-70869877 ATATATCACCATAAGCCCTGAGG + Intergenic
1151351760 17:73536108-73536130 CTATATCAGCATCACCCAGAGGG + Intronic
1156559716 18:38109433-38109455 ATATAAAAGCACAAACCATAAGG + Intergenic
1156602120 18:38619995-38620017 ATATATCAACATAAATTATATGG + Intergenic
1157650493 18:49324894-49324916 ATTTATCAGCATTACACATAAGG + Intronic
1157791324 18:50533828-50533850 ATTTCTCATCAGAATCCATATGG - Intergenic
1158187052 18:54782550-54782572 ATATATCAGAATAGCCAATAAGG - Intronic
1158756287 18:60329800-60329822 ATATGTCAGCCAATTCCATAAGG + Intergenic
1159543511 18:69811722-69811744 ATATATCAGAATCACCCAAAGGG - Intronic
1160164929 18:76502392-76502414 ATATATCACAATAACCCATGAGG + Intergenic
1164127161 19:22328997-22329019 ATATATCACAATGATCCACATGG - Intergenic
925393761 2:3518267-3518289 ATATTCCAGCATAATCTATTTGG - Intronic
925447090 2:3936367-3936389 ATATAGTAGCATAATCCTTTGGG + Intergenic
926965696 2:18407959-18407981 ATAAATAAGCTTCATCCATAAGG - Intergenic
927822414 2:26279656-26279678 ATATATCAGCAAGATCTAAAAGG - Intronic
928145736 2:28773536-28773558 ATAAATCAGCATACTTCATTAGG - Intronic
930345488 2:50175300-50175322 ATACATCTGCACAAACCATAAGG + Intronic
931902028 2:66800265-66800287 ATATATCATCAAAATGTATAAGG - Intergenic
931924441 2:67055986-67056008 AAACAGCATCATAATCCATAAGG - Intergenic
933493201 2:83015112-83015134 ATGTAGCAGCAAAAACCATATGG - Intergenic
934139691 2:89034233-89034255 ATTTATTATCATACTCCATAAGG + Intergenic
934229551 2:90166316-90166338 ATTTATTATCATACTCCATAAGG - Intergenic
935050118 2:99518192-99518214 GAATATCAGCAGAATCAATAAGG - Intergenic
937300722 2:120839168-120839190 ATATTTGAAGATAATCCATACGG - Intronic
937473161 2:122190895-122190917 TTGTATTAGCAAAATCCATATGG + Intergenic
937637613 2:124173980-124174002 TTATATCAGCATACTTCTTAAGG - Intronic
938731341 2:134150294-134150316 ATATAGCATCATGATCCAGAGGG - Intronic
942034231 2:171995223-171995245 ATTTATAGGCATAATCCAAATGG - Intronic
942737375 2:179130308-179130330 AGATATTAGAATAATCTATAAGG + Intronic
943808408 2:192152904-192152926 ATTTATCAGCATGTACCATAAGG + Intronic
943834645 2:192503476-192503498 ATATTTCTGCAATATCCATAAGG - Intergenic
944917114 2:204372545-204372567 ATATATATGCATAATCCCTTAGG - Intergenic
946565537 2:220960696-220960718 ATATATGAGCATTGTCCCTAGGG - Intergenic
946632972 2:221691310-221691332 ATATATCAGTATAATTAAGAAGG + Intergenic
948023837 2:234759947-234759969 AAATATCAGTATAAACCAAAGGG - Intergenic
1170671967 20:18442488-18442510 ATATATTAGCAAAATCTTTAAGG + Intronic
1171324257 20:24276964-24276986 ATATTTCAGCATTATTCAAAAGG - Intergenic
1177049973 21:16220838-16220860 ACTTACCAACATAATCCATAGGG + Intergenic
1177286361 21:19056564-19056586 ATATTTTAGCATAATTCCTAAGG - Intergenic
1177444311 21:21172025-21172047 ATAAATCAGCATAACACACATGG + Intronic
1177638320 21:23814687-23814709 ACATATCACCATATTACATATGG + Intergenic
1184206373 22:43006500-43006522 ATCTGTAAGCATAAACCATATGG + Intronic
949638034 3:6005665-6005687 ACAAATCAGCATAATCAATTTGG - Intergenic
951404201 3:22274353-22274375 ATATCTCATAATAATCTATATGG + Intronic
951429745 3:22592699-22592721 ACATATCCACATAATGCATATGG + Intergenic
951689268 3:25378521-25378543 ATAAATCGGCATCATCCAGAAGG + Intronic
952832304 3:37575306-37575328 ATTTAACAGCATATTCCATCAGG + Intronic
952995604 3:38878849-38878871 ATATCTGAGCATAAACCATGTGG - Intronic
957934616 3:86926548-86926570 ATGTATAAGCATATTACATAAGG + Intergenic
958268671 3:91470936-91470958 ATATATCAGCATAATCCATAAGG + Intergenic
964462140 3:156945002-156945024 ATAAATTAGTATAATCAATATGG - Intronic
964618928 3:158700998-158701020 AGATTTCAGCATAATAGATAAGG + Intronic
965807355 3:172555880-172555902 ATAAATCAGCATTATCGAGAAGG + Intergenic
971088743 4:23313988-23314010 GCATATTAGCATAATCAATAGGG + Intergenic
971652100 4:29291093-29291115 ATATATCAGTATAATCATAATGG + Intergenic
973069454 4:45838812-45838834 ATGTATAAGAATAATCCATGTGG + Intergenic
974215727 4:58843448-58843470 ATATATCAGCAGCATACACATGG + Intergenic
974626582 4:64433709-64433731 ATATATCAACATCATATATATGG + Intergenic
974768162 4:66375511-66375533 ATATATAAGAATAATCAATTTGG - Intergenic
976978831 4:91198608-91198630 ATAGAGCTGCATGATCCATAGGG + Intronic
977292945 4:95182800-95182822 GTATCTCAACATAGTCCATATGG - Intronic
979062788 4:116085878-116085900 ATATATAACCATAATATATAAGG + Intergenic
979336298 4:119466992-119467014 ATATTTTAGCACAATCCAGAGGG + Intergenic
980289403 4:130826101-130826123 AAATAACAGCATAACCCATCTGG - Intergenic
980372296 4:131891982-131892004 ATATATCACTATAATTCACAGGG - Intergenic
980520772 4:133931059-133931081 ATACATCAGTAAAATCCATTGGG - Intergenic
981801700 4:148665330-148665352 TTATATCTGCATAGTCCACATGG + Intergenic
981970067 4:150656845-150656867 ATAAATGAGCATTATTCATAAGG + Intronic
983239201 4:165212333-165212355 ATATTTTAGCACAATCCAGAGGG + Intronic
987036895 5:14028210-14028232 TTATAGCAGCATTATTCATAAGG + Intergenic
987231014 5:15893388-15893410 AGATATAAGCATAATACTTAGGG + Intronic
987257340 5:16169543-16169565 CTATATCAGCAAAGTCAATAAGG - Intronic
987763903 5:22200539-22200561 AGATATCTACATCATCCATAAGG + Intronic
991898626 5:71433618-71433640 AGATATCTACATCATCCATAAGG + Intergenic
995605596 5:113851336-113851358 ATTTATCAGCATAGACAATATGG + Intergenic
999742849 5:154569736-154569758 ATAACTCAGCATGATCCATTTGG - Intergenic
1008869532 6:56256030-56256052 AAACATCAGAATAATTCATAGGG - Intronic
1008986537 6:57550651-57550673 ATATATCAGCATAATCCATAAGG - Intronic
1009174502 6:60443220-60443242 ATATATCAGCATAATCCATAAGG - Intergenic
1009616345 6:66012392-66012414 ATATATCAGTACAATCACTATGG + Intergenic
1010484880 6:76398367-76398389 ATAAATCTGCATAAGCCAAAAGG - Intergenic
1010800809 6:80173599-80173621 ATGGATCAGAATAATCTATAGGG - Intronic
1013866163 6:114698764-114698786 AAATATAAGCAAAATCCACAGGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015776639 6:136821453-136821475 TTAAACCAGCATGATCCATAGGG - Intergenic
1017614306 6:156228532-156228554 ATTTATTAGCATAATCCTTTGGG - Intergenic
1018310908 6:162507439-162507461 ATATATACGCATATTCCTTAAGG + Intronic
1021364747 7:19763325-19763347 ATTCCTCAGAATAATCCATATGG + Intronic
1028729299 7:94127057-94127079 TTATATCAGCTTAATCCTTATGG + Intergenic
1030026208 7:105327123-105327145 ATTTAGCAGCATATTCCATGAGG + Intronic
1031705343 7:124974428-124974450 ACATATGAGCAGAATCCATAAGG + Intergenic
1038942895 8:32325086-32325108 TTATAACAGCATAATAAATAAGG - Intronic
1041072931 8:54142910-54142932 TTAAATCATAATAATCCATATGG - Intronic
1041850992 8:62392762-62392784 TTTTATCATCATAATTCATATGG + Intronic
1042881929 8:73502708-73502730 ATATATAAGCAAAATGCTTAAGG - Intronic
1044172028 8:89065701-89065723 ATATAAAAGCATAATGCAAAAGG - Intergenic
1047119033 8:121879496-121879518 ATGTATCATCATAGTCCAAATGG - Intergenic
1050748039 9:8900592-8900614 ATATATCAATGTAATCCAAAAGG - Intronic
1058408124 9:104700170-104700192 ATATAACAGTATAATGGATATGG + Intergenic
1059021052 9:110577489-110577511 ATGTAGCAGCTTAATCCATCTGG - Intronic
1059172941 9:112143778-112143800 ATATATGAGAAGAACCCATAAGG - Intronic
1185768701 X:2748312-2748334 ATATTGCAGCAGAATCCATATGG + Intergenic
1187666584 X:21617980-21618002 AAAGCTCAGCAAAATCCATAAGG - Intronic
1188161347 X:26807647-26807669 ATATATTTATATAATCCATATGG - Intergenic
1188864359 X:35296372-35296394 ATATAGCATCATAATCAATAGGG - Intergenic
1189726932 X:43976482-43976504 GTATACCAGCATAATCTATGAGG + Intergenic
1190549579 X:51564938-51564960 ATATATAAGCAGGTTCCATAAGG - Intergenic
1190795575 X:53738113-53738135 ATATATCAGGATACACCAGAAGG - Intergenic
1191959613 X:66686479-66686501 TTATATCTGCAAAATCCTTATGG - Intergenic
1196373557 X:115005051-115005073 AGATAACATCATAATCCATACGG + Intronic
1197497629 X:127204726-127204748 ATTTATCAGCATAATCATTTAGG - Intergenic
1197605189 X:128577233-128577255 ATATATCAGCACAAATAATATGG - Intergenic
1198505594 X:137297976-137297998 TAATATCTGCATAATTCATAGGG - Intergenic
1199447727 X:147945231-147945253 ATATATCTGTATGAACCATAAGG - Intronic
1200937203 Y:8748765-8748787 ATTAAGCAGCAAAATCCATAAGG - Intergenic