ID: 1009176592

View in Genome Browser
Species Human (GRCh38)
Location 6:60467484-60467506
Sequence GGGGGAAAACAGGCCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009176592_1009176600 11 Left 1009176592 6:60467484-60467506 CCTCTCTGGGCCTGTTTTCCCCC No data
Right 1009176600 6:60467518-60467540 AAGAAAGAGTGCCTGCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009176592 Original CRISPR GGGGGAAAACAGGCCCAGAG AGG (reversed) Intergenic
No off target data available for this crispr