ID: 1009177245

View in Genome Browser
Species Human (GRCh38)
Location 6:60475604-60475626
Sequence ATGCAGTTTTTGGGGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 2, 1: 1, 2: 3, 3: 24, 4: 310}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009177245 Original CRISPR ATGCAGTTTTTGGGGAAACA TGG (reversed) Intergenic
901178837 1:7325710-7325732 AAGCAGTTTTGGAGGAAGCATGG + Intronic
902052485 1:13575225-13575247 TTGCATTTTTTGTGGAGACAGGG + Intergenic
902107712 1:14051665-14051687 TTGTAGTTTTTGTGGAGACAGGG - Intergenic
903509443 1:23863677-23863699 TTACAGTTTTTGTGGAGACAAGG - Intronic
903630376 1:24764479-24764501 TTGCATTTTTTGTGGAGACAGGG - Intronic
905664830 1:39756832-39756854 ATGCAGTTTTGGAGGAAAGTGGG - Intronic
905948710 1:41926828-41926850 ATGGAGTTTTAGGGAAAATATGG + Intronic
906345725 1:45013130-45013152 ATGCAGAGTTTAGGGAAACCCGG + Exonic
906428568 1:45735395-45735417 ATGTTGTTTTTGTAGAAACAAGG + Intronic
906490720 1:46266472-46266494 ATGTAGTTCTTGGAGAAAGAGGG + Intronic
907287522 1:53391304-53391326 TTTCATTTTTTGTGGAAACAGGG + Intergenic
907743134 1:57186232-57186254 GGGCTGTTTTTGGAGAAACACGG - Intronic
907826038 1:58017703-58017725 ATGAGGTTTTTGGAGAAGCAAGG + Intronic
908748653 1:67399179-67399201 ATGCAGTTTTTCGGGGGAGAAGG + Intergenic
908813178 1:68005011-68005033 AAGGAGATTTTGGGCAAACAGGG + Intergenic
908862526 1:68505958-68505980 ATGCAGGATTTGGGGAATGACGG - Intergenic
909190945 1:72550423-72550445 ATGAAGTTTTTGGGGGCAAAGGG - Intergenic
909566213 1:77056146-77056168 ATGCTGTTTCTGGTGCAACATGG - Intronic
909609561 1:77538164-77538186 TTGCATTTTTTGGAGAGACAGGG - Intronic
910018910 1:82561031-82561053 ATGTTGTTTTTTGGCAAACAAGG - Intergenic
910804236 1:91174568-91174590 TTGTAGTTTTTGTGTAAACAGGG - Intergenic
911029541 1:93471517-93471539 TTGTATTTTTTGTGGAAACAGGG - Intronic
911065835 1:93787198-93787220 ATCCAGTCATTGGGGACACAGGG - Intronic
911583083 1:99657937-99657959 ATGCAGGTTGAGGGGAGACAGGG - Intronic
913178338 1:116295803-116295825 GTGCATTTTTTGTGGAGACAGGG - Intergenic
916093404 1:161327099-161327121 TTGCATTTTTTGTGGAAACAGGG + Intronic
918193588 1:182200073-182200095 TTGCATTTTTTGTAGAAACAGGG - Intergenic
918367329 1:183822116-183822138 ATGAAGTTTATGGGGTTACATGG + Intronic
918555557 1:185795384-185795406 ATGCAGCTCTTGGGAAAAAAAGG - Intronic
1063445892 10:6116612-6116634 ATGCAGTATTTGGGAAAGCAAGG - Exonic
1064039753 10:11950656-11950678 ATGCAGGTTTTTGGGAAACAAGG + Intronic
1064468138 10:15606125-15606147 ATGCAGTGTTTCAGGAAACATGG + Intronic
1065481560 10:26199378-26199400 TTGTAGTTTTTGTGGAGACAAGG - Intronic
1066334041 10:34458207-34458229 ATTTATTTTTTGGGGAGACAGGG + Intronic
1066466031 10:35651135-35651157 AGGGAGTTTGTGGGGAGACAAGG - Intergenic
1066723066 10:38359693-38359715 ATGCATTTTTTGGGCAGAGAGGG + Intergenic
1067790049 10:49281176-49281198 AGGCAATTTTGGGGGAAAAAAGG - Intergenic
1068263311 10:54613110-54613132 ATGCCCATTTTAGGGAAACACGG + Intronic
1069132822 10:64727706-64727728 TTGCAGCTTTTGGGGCATCACGG + Intergenic
1070451102 10:76557888-76557910 TTGCAGTTTTTCGGAGAACAAGG + Intronic
1070720992 10:78757023-78757045 ATGCCGTGCTGGGGGAAACAGGG - Intergenic
1071122684 10:82297967-82297989 TTGCAGTTTTTGTAGAGACAAGG - Intronic
1071229548 10:83569424-83569446 ATGGACTTTCTGGGGAAATAAGG + Intergenic
1071550233 10:86560987-86561009 ATGCATTTTTTGTAGAAGCAGGG - Intergenic
1071870264 10:89786576-89786598 ATTCAATATTTGGGGAAACTAGG - Intergenic
1072671711 10:97434867-97434889 ATGCAATTTTTGAAGAGACAGGG - Intergenic
1072694594 10:97593842-97593864 GTGCAGTGTCTGGGGAACCATGG + Intronic
1073107717 10:101041943-101041965 TTGCAGTTTTTGGCAATACAAGG - Intergenic
1073108069 10:101044086-101044108 TTGCAGTTTTTGGCAATACAAGG - Intergenic
1073989759 10:109249167-109249189 ATGAAGTTATTGGGGAAAGGGGG + Intergenic
1075973134 10:126672285-126672307 ATGGCGTTTTTGGGGACACAGGG - Intergenic
1076050848 10:127332082-127332104 ATGCTGTTTTGGTGGAAACTGGG + Intronic
1078606697 11:12783538-12783560 TTTCAGTTTTGGGGGAAACCTGG + Intronic
1079561040 11:21820070-21820092 ATGCAGGTGTTGGGGACAGAAGG - Intergenic
1079920222 11:26424567-26424589 ATGGAGTTTTGGGGGGAACAAGG - Intronic
1081191696 11:40111807-40111829 TTGCAGGTTTTGGGGATAAAGGG - Intergenic
1083464148 11:62834130-62834152 ATACAGCTTTTAGGGAAACCAGG + Intronic
1084393770 11:68895675-68895697 ATGCAGTTTTTTTTGAGACAGGG + Intronic
1088277918 11:108108666-108108688 TTGCAGTTTTAGTGGAGACAGGG + Intergenic
1088864106 11:113830082-113830104 ATGTATTTTTTGGAGAAACTGGG - Intronic
1090279965 11:125447332-125447354 ATGCATTTGTTGGAGAAACTAGG - Intronic
1090884943 11:130867684-130867706 ATGCATTTTTAGGACAAACATGG + Intergenic
1090917584 11:131179575-131179597 AAGCAGTATTAGGTGAAACAGGG - Intergenic
1091500452 12:1011772-1011794 TTGCATTTTTAGGGGAGACAGGG - Intronic
1092445332 12:8550600-8550622 AAGCAGTATTTGGGGAAGCCAGG + Intergenic
1093724982 12:22495084-22495106 ATGCAATTTTTTGGGAAAATAGG - Intronic
1094121738 12:26982206-26982228 TTGTATTTTTTGGAGAAACAGGG + Intronic
1097807108 12:63977948-63977970 ATGCAGTTTTGGGGCATTCATGG + Intronic
1099507852 12:83500773-83500795 ATACAGTTATTGGGTAAATATGG - Intergenic
1100494197 12:95109688-95109710 TTGGATTTTTTGTGGAAACAAGG - Intronic
1101173564 12:102125363-102125385 ATGCAGATTTTGGGGTGAAAGGG + Intronic
1101372543 12:104142497-104142519 ATACAGTGTTTTGGGAAGCATGG - Intergenic
1102079763 12:110088433-110088455 TTTAAGTTTTTGAGGAAACAAGG + Intergenic
1103221903 12:119253200-119253222 CTGCTATGTTTGGGGAAACAAGG - Intergenic
1103287357 12:119813668-119813690 ATGCCTTTTTTGGGGGAAGATGG - Intronic
1103844992 12:123895443-123895465 ATGCAGTTTTGGGGGAAAAGGGG + Intronic
1103944138 12:124517051-124517073 CTGCAGTTTTAGGGGGAACGCGG - Intronic
1104203296 12:126613232-126613254 ATGCAGTTTTGGGGGAACAATGG + Intergenic
1104203981 12:126618342-126618364 GTGCAGTTTTGGGGGAACAATGG + Intergenic
1105447551 13:20470734-20470756 TTGTAGTTTTAGTGGAAACAGGG - Intronic
1107295045 13:38899362-38899384 ATGCAGATATTGGGAAACCAGGG - Intergenic
1107357468 13:39583345-39583367 ATGTATTTTTTGTAGAAACAGGG + Intronic
1109914495 13:68963034-68963056 TTGTTGTTTTTGGGGGAACAGGG - Intergenic
1111569201 13:90057751-90057773 ATACAGTTTTTTGAGAAACATGG - Intergenic
1111750401 13:92323276-92323298 ATGTATTTTTTGGTAAAACATGG - Intronic
1116805255 14:49488233-49488255 ATCACGTTTTTGGGGTAACATGG - Intergenic
1117257749 14:53997207-53997229 ATGTAGTTTTTGGGGTCAGAAGG + Intergenic
1118454819 14:65935005-65935027 ATGCAGGTGCTGGGGACACAAGG + Intergenic
1119330305 14:73788294-73788316 AAGCAGTATTTGGGGAAAAAAGG - Intronic
1119801528 14:77449492-77449514 ATGCTGTCTTTGGGGAAGAACGG - Intronic
1120032695 14:79660685-79660707 AAACAGTTTTAGGGGAAGCATGG - Intronic
1125025950 15:35029429-35029451 AATCAGTTTTTGAGAAAACATGG + Intergenic
1125974884 15:43942519-43942541 ATGCATTTTTTGGGAGAAGAGGG - Intronic
1126031643 15:44505257-44505279 TTGCATTTTTTGTGGAGACAAGG - Intronic
1126536727 15:49774456-49774478 TTGCAGTTTTTGTAGAGACAGGG + Intergenic
1126546308 15:49878149-49878171 AAGCAGTTTCTGGGAAAAGATGG - Intronic
1127025423 15:54799952-54799974 CTGCAATTTGTGGGGAAAAAAGG - Intergenic
1127043776 15:55004565-55004587 AGGCAGTGTATGGGGAAAAAGGG + Intergenic
1128003723 15:64218559-64218581 TTGCATTTTTTGGAGAGACAGGG + Intronic
1128251949 15:66169927-66169949 ATGCAGTTTCTGTGGACTCATGG - Intronic
1129292199 15:74576968-74576990 AAGCGCTTTTTGGGCAAACATGG - Intronic
1129949137 15:79570752-79570774 ATGCAGCTATTGGGGGAACCTGG - Intergenic
1130228109 15:82075441-82075463 AAGCAGTTTGTGGGGAGAAAGGG + Intergenic
1130761279 15:86822674-86822696 ATGCAGTTTTTCAGGAAAGAAGG + Intronic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1133317863 16:4895205-4895227 ACAAAGTTTTTGGGGTAACATGG - Intronic
1134766775 16:16765957-16765979 AGGTAGTTTATGTGGAAACATGG + Intergenic
1135567051 16:23519213-23519235 TTGCATTTTTTGTAGAAACAGGG + Intronic
1136509993 16:30731687-30731709 TTTCAGTTTTTGAGGAGACAGGG - Intronic
1137044928 16:35645877-35645899 ATGCAGTTTTTGAGGAAATCAGG - Intergenic
1137438248 16:48476021-48476043 ATGGTGTCTTTGGGGGAACATGG + Intergenic
1138666714 16:58575874-58575896 ATACAGTTTTTGGGGAAACTAGG - Intronic
1139165654 16:64562356-64562378 ATGCAGCTTTTGGAGAGAAAGGG + Intergenic
1140778662 16:78274133-78274155 AAGCAGTGTTTGGGGAGACCAGG - Intronic
1142804033 17:2362307-2362329 CTGCAGTTTTGGGGGGAACGGGG - Intronic
1142804059 17:2362395-2362417 CTGCAGTTTTGGGGGGAACGGGG - Intronic
1143824297 17:9591705-9591727 TTTCAGTTTTTGTGGAAACAGGG - Intronic
1146282244 17:31552182-31552204 GTAAAGATTTTGGGGAAACATGG + Intergenic
1146717797 17:35100927-35100949 GTGCTGTTGTTTGGGAAACAGGG - Exonic
1147182030 17:38692526-38692548 TTGCATTTTTTGTGGAGACAGGG - Intergenic
1148646951 17:49224712-49224734 CTGCAGTTTGTGGCAAAACAGGG - Exonic
1149516034 17:57281627-57281649 ACGCAGTATATTGGGAAACAAGG - Intronic
1149619478 17:58032109-58032131 TTGCATTTTTTGTGGAGACAGGG - Intergenic
1149909456 17:60553594-60553616 TTGCATTTTTTGTAGAAACAGGG + Intergenic
1150193338 17:63267024-63267046 GTGCATTTTTTGTGGAGACAGGG + Intronic
1150489141 17:65562326-65562348 ATGCAGTTGTTTGGGAGAGATGG - Intronic
1151539847 17:74759301-74759323 GTGCAGTTCAAGGGGAAACAGGG - Intronic
1153127840 18:1817606-1817628 AACAAGTTTTTGGGGAAAAATGG - Intergenic
1154139673 18:11811726-11811748 ATTCCTTTTTTGGGGGAACAAGG - Intronic
1154940533 18:21108958-21108980 ATGACATGTTTGGGGAAACAAGG - Intronic
1156445582 18:37234322-37234344 CTGAACTTTTTGGGGAAATAAGG - Intergenic
1158111970 18:53950124-53950146 ATGAGGCTTATGGGGAAACAAGG + Intergenic
1158769054 18:60492617-60492639 ATGTATTTTTTGGGGGTACATGG + Intergenic
1158799315 18:60887859-60887881 CTGTAGTTTTTGCTGAAACAAGG - Intergenic
1159514390 18:69438896-69438918 TTGTAGTTTTTGTAGAAACAAGG - Intronic
1161171741 19:2815570-2815592 CTGGAGTGTTTGGGGAAACCCGG - Exonic
1161649575 19:5476134-5476156 TTGTAGTTTTTGGAGAGACAGGG - Intergenic
1162625351 19:11880544-11880566 GTGCAGTTTTGGGGGAACAATGG - Intronic
1163439611 19:17315062-17315084 ATATGGTTTTTGGTGAAACAGGG - Intronic
1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG + Intergenic
1165202509 19:34156661-34156683 TTGTATTTTTTGTGGAAACAGGG - Intergenic
1167238893 19:48331557-48331579 AGGCAGCCTTTGGGGAGACAGGG - Intergenic
1167495317 19:49814546-49814568 TTGTAGTTTTTGTGGAGACAGGG + Intronic
1167716360 19:51144836-51144858 ATGCAGCTCCTGGGGAGACAGGG + Intronic
1168619430 19:57866130-57866152 TTGCATTTTTTGTGGACACAGGG + Intronic
926071637 2:9898734-9898756 ATACACTTTTGGGGGAAATACGG - Intronic
927751947 2:25677211-25677233 GTGCATTTTTAGGAGAAACAGGG - Intergenic
929134093 2:38606271-38606293 TTACAATTTTTGTGGAAACAGGG - Intergenic
929582704 2:43093150-43093172 ATGCAGAAGTTGGGGAGACAGGG + Intergenic
929688278 2:44053427-44053449 AGGAAGTTTTTTGGGTAACAAGG - Intergenic
931810578 2:65850758-65850780 CTGCAGTTGTAAGGGAAACAAGG - Intergenic
932237685 2:70134141-70134163 ATGCAGTTTCTGGGCAGACTGGG + Intergenic
933206996 2:79518233-79518255 AGGCAGTTTTGGGGGAAGCCAGG + Intronic
933260140 2:80123238-80123260 CTGCAGTTTATGGAGAAACCGGG + Intronic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
934638644 2:96012606-96012628 TTGCATTTTTAGGGGAGACAGGG + Intergenic
934795006 2:97092796-97092818 TTGCATTTTTAGGGGATACAGGG - Intronic
935189156 2:100762003-100762025 ATGCAGTTTTAGGGGTAGTATGG - Intergenic
935354733 2:102187689-102187711 GGGCAGTCTTTGGGGAAACGTGG + Intronic
935468098 2:103423501-103423523 ATGCTATTTTTGGGGAAAAAAGG + Intergenic
935554636 2:104495745-104495767 AAGTATTTTTTGGGGAGACATGG - Intergenic
936053184 2:109240976-109240998 ATGGAGTTTTTGGGGAGATGTGG - Intronic
936482495 2:112897822-112897844 ATGCAGTGTTGGGGGAAGCGAGG + Intergenic
936996978 2:118425822-118425844 ATGGAGATTTTGGGGACATAGGG - Intergenic
939604106 2:144231593-144231615 AAGCAGTTTTTTGGTAAATACGG - Intronic
940608203 2:155955153-155955175 ATGCAATTTAGGGGGAAAGAAGG + Intergenic
941034692 2:160555482-160555504 ATGCACATATTGGGGAACCAAGG + Intergenic
941176038 2:162198542-162198564 AAACAGAGTTTGGGGAAACAGGG - Intronic
941629945 2:167872905-167872927 ATGGAGCTTTTGGTGAAGCAAGG + Exonic
941826282 2:169900553-169900575 ATGCAGTCTTTGCGGCAAAATGG + Intronic
941943588 2:171070461-171070483 ATGCAACTTATGGGGAAAGAGGG - Intronic
942473957 2:176294834-176294856 ATACAGTTTTTGGGGAAAAACGG + Intronic
943489401 2:188531677-188531699 ATGTAGTTTGCTGGGAAACAAGG + Intronic
945780320 2:214162919-214162941 ATGCATTTTTTGCCTAAACAAGG - Intronic
947128172 2:226893952-226893974 GAGCAGTTTTTGGGGGGACATGG + Intronic
947779440 2:232744301-232744323 AAGGAGTCTTTGGGGAGACATGG + Intronic
1169450950 20:5710492-5710514 GTGCAGATTTTGGGGGCACAAGG + Intergenic
1170990349 20:21295832-21295854 TTGCATTTTTTGTGGAGACAGGG + Intergenic
1171940885 20:31328694-31328716 ATGCAGTTTGTGAGGAAAGCAGG - Intergenic
1172251819 20:33485003-33485025 ATTTAGTTTTTGTAGAAACAGGG + Intergenic
1172388449 20:34549890-34549912 ATGGAGTCCTGGGGGAAACAGGG - Exonic
1174625887 20:51913960-51913982 ATGCATTTTTAGTAGAAACAGGG - Intergenic
1175570217 20:60012513-60012535 ATGGAGTTTCTGGGGAAAAGTGG - Exonic
1177141726 21:17365165-17365187 ATGCAGCTTATGTGGAAACTTGG + Intergenic
1179224059 21:39436964-39436986 ATGCAGTTAGTGGGGAAGCCAGG - Intronic
1182633357 22:31705085-31705107 TTGTATTTTTTGTGGAAACAAGG - Intronic
1182894403 22:33847061-33847083 TTGCAGCTTGTGGGGAATCACGG + Intronic
1182952995 22:34395293-34395315 CTGTAGTTTTTAGGGAACCACGG - Intergenic
1183109851 22:35641059-35641081 AAGCAGTTTTTGGGGCAAGAGGG - Intergenic
1183781276 22:40000483-40000505 TTGCAGTTAATGGGGAAAGACGG - Intronic
1183898520 22:40988180-40988202 ATGCGATCTTTGTGGAAACAGGG - Intergenic
1185357569 22:50383424-50383446 ATTCTGTATTTGGGAAAACACGG - Intronic
949251003 3:1983759-1983781 TTGTAGTTTTTGTGGAAACTGGG - Intergenic
950811795 3:15656305-15656327 ATGCAGTTTGAGGGGAACAATGG - Intergenic
951049832 3:18081853-18081875 ATGCAGCTTTTAGGGTGACAGGG + Intronic
953247599 3:41209373-41209395 ATGCAGCTTTGGGGAAAACCGGG - Intronic
953994658 3:47510630-47510652 TTGCATTTTTTGTAGAAACAGGG + Intronic
956012206 3:64843932-64843954 ATGCATTTCATGGGGAAAGAAGG - Intergenic
956490016 3:69760775-69760797 AGGCAGTTTTTGAGGTAACCAGG + Intronic
956680301 3:71773150-71773172 TTGCAGTTTTAGTAGAAACAGGG + Intronic
957304976 3:78445674-78445696 TTGCATTTTTTGTGGAGACAGGG - Intergenic
958266571 3:91444576-91444598 ATGCAGTTTTGGGGGAAACATGG + Intergenic
958993166 3:100871322-100871344 ATGTAGTTTTTAAAGAAACATGG + Intronic
959182323 3:102997322-102997344 TTTTAGTTTTTGGAGAAACAGGG - Intergenic
960120268 3:113942084-113942106 TTGCAGTTTTTGTAGAGACAAGG + Intronic
961020592 3:123503089-123503111 CTGTATTTTTTGTGGAAACAGGG - Intronic
963102282 3:141619081-141619103 ATGGAGTTTTTGGGGAAGGCTGG - Intergenic
965014754 3:163142643-163142665 ATGCTGTTTCTGGGAAAAAAAGG - Intergenic
965016384 3:163163365-163163387 ATGCAGTCATTAGAGAAACATGG - Intergenic
966198648 3:177338884-177338906 ATGCATTTTATGGTGAAACAAGG - Intergenic
966581906 3:181576682-181576704 TTGCACTTTTTGTAGAAACAGGG + Intergenic
966641833 3:182200441-182200463 ATGCATATTTTGTGGATACATGG + Intergenic
967235032 3:187375916-187375938 ATGCAGTATTTGGTAAAACCAGG + Intergenic
967542509 3:190684131-190684153 ATGCACTTTTAAGTGAAACATGG + Intergenic
967696144 3:192533329-192533351 ATTCAGGTTTTTGGGGAACAAGG + Intronic
969925230 4:10579129-10579151 ATACAGTATTTGGGGAAAGAGGG + Intronic
970326277 4:14928278-14928300 AAGCATTTTATGGGGTAACAGGG + Intergenic
971597753 4:28553762-28553784 ATGCAGTTTCAGTGGAAACCCGG + Intergenic
972615126 4:40690838-40690860 ATGCAGCCTTTGGGGAGACCTGG + Intergenic
973691417 4:53437152-53437174 TTGCATTTTTTGTGGAGACAGGG - Intronic
974355229 4:60803994-60804016 ATGCAGCTTTCGGGGAGCCAGGG - Intergenic
974673599 4:65062426-65062448 GTGCCCTTTTTGGGAAAACATGG + Intergenic
979092937 4:116509889-116509911 CTGTAGTTTTTGTGGAGACAGGG + Intergenic
979554016 4:122024208-122024230 TTGCAGTTTTTGTAGAAACGGGG - Intergenic
980304448 4:131039421-131039443 ATGCTGTTTTCTGAGAAACATGG + Intergenic
980693680 4:136328882-136328904 AGGTACTTCTTGGGGAAACACGG - Intergenic
981498944 4:145425805-145425827 TTGCAGTTTTTGTAGAGACAGGG - Intergenic
981742931 4:148021795-148021817 ACACAGATTTTGTGGAAACATGG + Intronic
982457750 4:155630566-155630588 TTGTAATTTTTGTGGAAACAGGG + Intergenic
983464917 4:168075077-168075099 TTGTAGCTTTTGTGGAAACATGG + Intergenic
985118326 4:186614681-186614703 CTGCAGTTTTTAGGTAAATACGG - Intronic
986038618 5:3964647-3964669 TTGCATTTTTTGCAGAAACAGGG + Intergenic
986454822 5:7906805-7906827 ATGTGTTTTTTGGGAAAACAAGG - Intergenic
987045434 5:14103323-14103345 GTGCAGTTTTGGGGGAATAAGGG - Intergenic
987750848 5:22037451-22037473 ATGCCTTTTTCAGGGAAACAAGG - Intronic
988898268 5:35701970-35701992 ATGCAATTTTTTTGGAGACAGGG - Intronic
991400508 5:66246235-66246257 GTGCAGTTTTGGGGAAATCAGGG + Intergenic
992272589 5:75080814-75080836 ATACTGTTTTTGGGGAAATAAGG - Intronic
992770143 5:80040018-80040040 ATTCAATTTTGGGGAAAACAGGG - Intronic
993039567 5:82797508-82797530 ATTCATTTTTTGAAGAAACAGGG - Intergenic
993521522 5:88908219-88908241 AGTCAGCTTTTGGAGAAACAAGG - Intergenic
994711440 5:103269299-103269321 GAGCCATTTTTGGGGAAACAGGG - Intronic
994728948 5:103469713-103469735 ATGTAGTATTTCGGGGAACAGGG - Intergenic
995516783 5:112962248-112962270 TTGTAGTTTTAGGAGAAACAGGG - Intergenic
996729968 5:126707460-126707482 CTGCAGTAATTGGGGAAAAAAGG + Intergenic
998136457 5:139676791-139676813 AAGCAGTGTCTGGGGTAACAGGG - Intronic
999565360 5:152854182-152854204 ATCTAGTTCTTAGGGAAACATGG + Intergenic
1002577812 5:180185923-180185945 TTGCATTTTTTGGAGAGACAGGG - Intronic
1003870002 6:10394346-10394368 AAGCAGGATTTGGGGAAACCAGG + Intronic
1004395910 6:15246199-15246221 ATGTAGTTTTTGGAGGAAAAAGG + Intergenic
1004624656 6:17363330-17363352 TTGCATTTTTTGTGGAGACAAGG + Intergenic
1004803779 6:19179787-19179809 ATGCAGTTTCGGGGGAACAATGG + Intergenic
1005196125 6:23286398-23286420 ATGCTGGATTTGAGGAAACAAGG - Intergenic
1005226232 6:23645780-23645802 ATGAAGTTATTTGGAAAACAAGG + Intergenic
1005363189 6:25052197-25052219 AGACAGTTTTTGTGGAATCAAGG + Intergenic
1005390701 6:25330396-25330418 ATGAAGATTTTGGGGAGCCAGGG + Intronic
1008325458 6:50175442-50175464 TTGTAGTGTTTGGGGAGACAGGG - Intergenic
1008988643 6:57577045-57577067 ATGCAGTTTTTGGGGAAACATGG - Intronic
1009177245 6:60475604-60475626 ATGCAGTTTTTGGGGAAACATGG - Intergenic
1009310702 6:62148996-62149018 GGGCAGTTATTGGGGAAAGAGGG - Intronic
1009505061 6:64467801-64467823 ATGCACCTTTTGGGGACCCAGGG + Intronic
1009622283 6:66093333-66093355 ATCCAGTTTTGAGGGAAAAAAGG + Intergenic
1009853872 6:69233900-69233922 ATGAAGTTTTTGTGAAAGCATGG + Intronic
1010510854 6:76717425-76717447 ATGCAGATGTTTGTGAAACAGGG - Intergenic
1010617599 6:78031451-78031473 ATCCAGTATGTGGGAAAACAAGG - Intergenic
1010996621 6:82540860-82540882 AAGAATTTTTTGTGGAAACATGG - Intergenic
1011477398 6:87761405-87761427 TTGCATTTTTTGTAGAAACAGGG - Intergenic
1011484542 6:87828539-87828561 AGGCAGTTAGTGAGGAAACAGGG - Intergenic
1011810401 6:91125987-91126009 CTGTAGTGTTTGGGGAATCATGG - Intergenic
1012310183 6:97714448-97714470 ATGCCTTTTTTGGGGATACATGG - Intergenic
1013257173 6:108399358-108399380 TTGTAGTTTTTGGAGAGACAGGG + Intronic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1015438691 6:133221731-133221753 ATTTAGTTTTTGTGGAGACAGGG + Intergenic
1016155046 6:140795732-140795754 ATGAAGTTTTTCAGTAAACATGG + Intergenic
1016320716 6:142842653-142842675 TTGCAGTCTTTCAGGAAACAAGG - Intronic
1016328887 6:142935374-142935396 TTGCACTTTTTGTGGAGACAGGG - Intronic
1016899823 6:149090508-149090530 AGGCAGGCTTTGGGGAACCAGGG + Intergenic
1018002490 6:159591959-159591981 TTGCAGTTTTTGTAGAGACAGGG - Intergenic
1018447254 6:163869239-163869261 CTGTATTTTTTGTGGAAACAGGG + Intergenic
1020239774 7:6384641-6384663 TTGAATTTTTTGTGGAAACAAGG + Intronic
1020435416 7:8157392-8157414 AGGCAGCATTTGGGGAAACAGGG - Intronic
1020722707 7:11768405-11768427 ATGCAATCTTTGTGGCAACATGG + Intronic
1021698483 7:23295722-23295744 TGGCAGTTTTGGGGGAAAGAGGG + Intergenic
1022394236 7:29971458-29971480 TTGTATTTTTTGTGGAAACAGGG - Intronic
1024155914 7:46624933-46624955 GTGAAGTTTTAGGGGCAACACGG + Intergenic
1025936328 7:66040760-66040782 ATGTATTTTTAGGAGAAACAGGG - Intergenic
1026094379 7:67331457-67331479 AATCAGCTTTTGGAGAAACAAGG + Intergenic
1026486009 7:70822003-70822025 TTGTATTTTTTGGGGAGACAGGG - Intergenic
1026514061 7:71052176-71052198 TTGCAGTATTTTGGGAGACAAGG + Intergenic
1026895094 7:74005755-74005777 CTGTAGTTTTTGGTGAGACAGGG - Intergenic
1030205975 7:106953127-106953149 ATGCCATTTATGGGGAAGCAGGG - Intergenic
1030941180 7:115651388-115651410 TTGCATTTTTTGTGGAGACAGGG + Intergenic
1033204314 7:139404335-139404357 TTGCAGTTTTTGTAGAAACAGGG - Intronic
1036024769 8:4893858-4893880 TTTCTGTTTTTGGGGAAAAAAGG - Intronic
1036812696 8:11878577-11878599 AGGCTGTTCTTGGGGGAACAGGG - Intergenic
1038166341 8:25088260-25088282 ATGGAGACTTTGGGAAAACACGG + Intergenic
1038175550 8:25179214-25179236 TTGCATTTTTTGTAGAAACAGGG + Intergenic
1039306196 8:36265986-36266008 AGGCATGTTTTGGGGAAACCTGG - Intergenic
1039872164 8:41555642-41555664 ATTCAGTTTTTTTGGAGACAGGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041989607 8:63970337-63970359 ATTTAGTTATTGGGGACACATGG - Intergenic
1042439003 8:68802668-68802690 TTGTAGTTTTTGTGGAGACAAGG + Intronic
1042725714 8:71874355-71874377 ATGCAATATTTGAGGACACATGG + Intronic
1042999356 8:74738313-74738335 AGCCAGCATTTGGGGAAACAAGG - Intronic
1044080727 8:87879718-87879740 ATGCTTTCTTTGGTGAAACAGGG + Intergenic
1046227151 8:111297073-111297095 TTGTAATTTTTGTGGAAACAGGG - Intergenic
1046542844 8:115609017-115609039 TTGTATTTTTTGTGGAAACAGGG + Intronic
1046740780 8:117826641-117826663 ATGAAGTATTTTGGGAAACTGGG + Intronic
1047013228 8:120695038-120695060 AGGCAGCTTTTGGGTTAACAGGG + Intronic
1047091746 8:121582802-121582824 ATACAATCTCTGGGGAAACATGG + Intergenic
1047893707 8:129342283-129342305 ATTCATTTTTTGTAGAAACAGGG + Intergenic
1048461252 8:134623483-134623505 ATGCAGATTTGGAGGAAAAAGGG - Intronic
1049351438 8:142166912-142166934 ATGCACATCTTGGGGAGACAGGG - Intergenic
1051112997 9:13661394-13661416 ATGCAGTATTTGTGCAAATATGG - Intergenic
1051405279 9:16730445-16730467 GTGCAGTTTAGGGGGAAAAAAGG - Intronic
1051694292 9:19751600-19751622 AATCATTTTTTGGGGAAAAAAGG + Intronic
1051733309 9:20170533-20170555 GTGCAGTTTTGGGGGAAAAATGG + Intergenic
1053005089 9:34599040-34599062 ATGCAGTGGTTGGGGAACCCTGG + Intergenic
1053507656 9:38657470-38657492 ATGTTGTTTTTGGGGAAGAATGG + Intergenic
1056059006 9:82863099-82863121 ATGCAAGTTTTGGGGGAAAAAGG - Intergenic
1058124325 9:101173982-101174004 TTAAAGTTTTTGTGGAAACAGGG - Intronic
1058335549 9:103823846-103823868 ATGCAGTTATTTGGGAAAAATGG + Intergenic
1059049644 9:110909919-110909941 TTGCATTTTTTGGAGAGACAGGG + Intronic
1059717703 9:116929126-116929148 ATGCTTGTTTAGGGGAAACAAGG + Intronic
1061742786 9:132719354-132719376 CTGTAGTTTTTGAAGAAACAGGG - Intergenic
1061774752 9:132954263-132954285 TTGCATTTTTTGTAGAAACAAGG + Intronic
1185509855 X:655807-655829 GTGCAGTTTTATGGGAAACACGG - Intronic
1185884166 X:3767291-3767313 TTGCATTTTTTGTGGAGACAGGG + Intergenic
1186631809 X:11357609-11357631 ATGCAGCTTTGGGGGAAGAAAGG - Intronic
1188965623 X:36547319-36547341 ATGTACACTTTGGGGAAACATGG - Intergenic
1189646951 X:43143376-43143398 ATTCAGCATCTGGGGAAACACGG - Intergenic
1189787539 X:44572776-44572798 ATGCAGTTTCAGGGGAACAATGG + Intergenic
1190732976 X:53236650-53236672 CTGCAGTTTTGGGGGAGACAAGG - Intronic
1191763057 X:64664668-64664690 ATGTGCTTTCTGGGGAAACATGG - Intergenic
1194402205 X:93452411-93452433 ATGCAGCTTCTGTGGAAACTAGG + Intergenic
1195305645 X:103580627-103580649 TTGTAATTTTTGCGGAAACAGGG + Intronic
1198058580 X:133020721-133020743 ATGCTGGCTTTGGGGAAAAAGGG + Intergenic
1198549233 X:137727143-137727165 TTGCATTTTTTGTGGAGACAGGG - Intergenic
1198712121 X:139516243-139516265 AGGCATTATTTGTGGAAACAAGG + Intergenic
1201616968 Y:15911449-15911471 ATGCAGTTTCTGGGCTATCAAGG + Intergenic