ID: 1009187863

View in Genome Browser
Species Human (GRCh38)
Location 6:60595400-60595422
Sequence GACCTACACACTTTGGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009187863_1009187869 -1 Left 1009187863 6:60595400-60595422 CCTGAACCCAAAGTGTGTAGGTC No data
Right 1009187869 6:60595422-60595444 CAGTTTTAGGAGGGTTCATATGG No data
1009187863_1009187871 14 Left 1009187863 6:60595400-60595422 CCTGAACCCAAAGTGTGTAGGTC No data
Right 1009187871 6:60595437-60595459 TCATATGGAATTTTAGGATATGG No data
1009187863_1009187870 8 Left 1009187863 6:60595400-60595422 CCTGAACCCAAAGTGTGTAGGTC No data
Right 1009187870 6:60595431-60595453 GAGGGTTCATATGGAATTTTAGG No data
1009187863_1009187868 -10 Left 1009187863 6:60595400-60595422 CCTGAACCCAAAGTGTGTAGGTC No data
Right 1009187868 6:60595413-60595435 TGTGTAGGTCAGTTTTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009187863 Original CRISPR GACCTACACACTTTGGGTTC AGG (reversed) Intergenic
No off target data available for this crispr