ID: 1009196751

View in Genome Browser
Species Human (GRCh38)
Location 6:60695573-60695595
Sequence CCTGATGACCAGCTGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009196747_1009196751 2 Left 1009196747 6:60695548-60695570 CCAGAGGACAAAGGGAGACATGG No data
Right 1009196751 6:60695573-60695595 CCTGATGACCAGCTGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009196751 Original CRISPR CCTGATGACCAGCTGCAGAA AGG Intergenic
No off target data available for this crispr