ID: 1009202872

View in Genome Browser
Species Human (GRCh38)
Location 6:60767349-60767371
Sequence CAGGTATAATATGCCATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009202863_1009202872 24 Left 1009202863 6:60767302-60767324 CCAGTGAGATTTGGGAGAGCCCC No data
Right 1009202872 6:60767349-60767371 CAGGTATAATATGCCATGGATGG No data
1009202865_1009202872 5 Left 1009202865 6:60767321-60767343 CCCCATAATGTGGATCAGAGTTT No data
Right 1009202872 6:60767349-60767371 CAGGTATAATATGCCATGGATGG No data
1009202867_1009202872 3 Left 1009202867 6:60767323-60767345 CCATAATGTGGATCAGAGTTTCC No data
Right 1009202872 6:60767349-60767371 CAGGTATAATATGCCATGGATGG No data
1009202866_1009202872 4 Left 1009202866 6:60767322-60767344 CCCATAATGTGGATCAGAGTTTC No data
Right 1009202872 6:60767349-60767371 CAGGTATAATATGCCATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009202872 Original CRISPR CAGGTATAATATGCCATGGA TGG Intergenic
No off target data available for this crispr