ID: 1009206646

View in Genome Browser
Species Human (GRCh38)
Location 6:60810378-60810400
Sequence CCTTATAAGTCCAGGGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009206646_1009206650 0 Left 1009206646 6:60810378-60810400 CCGGCTTCCCTGGACTTATAAGG No data
Right 1009206650 6:60810401-60810423 AAACAATTGCAGATACTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009206646 Original CRISPR CCTTATAAGTCCAGGGAAGC CGG (reversed) Intergenic
No off target data available for this crispr