ID: 1009206647

View in Genome Browser
Species Human (GRCh38)
Location 6:60810378-60810400
Sequence CCGGCTTCCCTGGACTTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009206643_1009206647 -9 Left 1009206643 6:60810364-60810386 CCCAGATTTATTGGCCGGCTTCC No data
Right 1009206647 6:60810378-60810400 CCGGCTTCCCTGGACTTATAAGG No data
1009206644_1009206647 -10 Left 1009206644 6:60810365-60810387 CCAGATTTATTGGCCGGCTTCCC No data
Right 1009206647 6:60810378-60810400 CCGGCTTCCCTGGACTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009206647 Original CRISPR CCGGCTTCCCTGGACTTATA AGG Intergenic
No off target data available for this crispr