ID: 1009206648

View in Genome Browser
Species Human (GRCh38)
Location 6:60810385-60810407
Sequence ATTGTTTCCTTATAAGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009206648_1009206650 -7 Left 1009206648 6:60810385-60810407 CCCTGGACTTATAAGGAAACAAT No data
Right 1009206650 6:60810401-60810423 AAACAATTGCAGATACTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009206648 Original CRISPR ATTGTTTCCTTATAAGTCCA GGG (reversed) Intergenic
No off target data available for this crispr