ID: 1009206650

View in Genome Browser
Species Human (GRCh38)
Location 6:60810401-60810423
Sequence AAACAATTGCAGATACTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009206644_1009206650 13 Left 1009206644 6:60810365-60810387 CCAGATTTATTGGCCGGCTTCCC No data
Right 1009206650 6:60810401-60810423 AAACAATTGCAGATACTTAGAGG No data
1009206649_1009206650 -8 Left 1009206649 6:60810386-60810408 CCTGGACTTATAAGGAAACAATT No data
Right 1009206650 6:60810401-60810423 AAACAATTGCAGATACTTAGAGG No data
1009206643_1009206650 14 Left 1009206643 6:60810364-60810386 CCCAGATTTATTGGCCGGCTTCC No data
Right 1009206650 6:60810401-60810423 AAACAATTGCAGATACTTAGAGG No data
1009206648_1009206650 -7 Left 1009206648 6:60810385-60810407 CCCTGGACTTATAAGGAAACAAT No data
Right 1009206650 6:60810401-60810423 AAACAATTGCAGATACTTAGAGG No data
1009206646_1009206650 0 Left 1009206646 6:60810378-60810400 CCGGCTTCCCTGGACTTATAAGG No data
Right 1009206650 6:60810401-60810423 AAACAATTGCAGATACTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009206650 Original CRISPR AAACAATTGCAGATACTTAG AGG Intergenic
No off target data available for this crispr