ID: 1009207094

View in Genome Browser
Species Human (GRCh38)
Location 6:60815255-60815277
Sequence GGGTGAACAGAGTGTGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009207094_1009207101 27 Left 1009207094 6:60815255-60815277 CCCATCTCACACTCTGTTCACCC No data
Right 1009207101 6:60815305-60815327 TTTCTTATATGTTCTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009207094 Original CRISPR GGGTGAACAGAGTGTGAGAT GGG (reversed) Intergenic
No off target data available for this crispr