ID: 1009219748 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:60969105-60969127 |
| Sequence | GTAGTAGTTTCTATTCTCCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 190 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 13, 4: 174} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1009219748_1009219751 | 22 | Left | 1009219748 | 6:60969105-60969127 | CCATGGAGAATAGAAACTACTAC | 0: 1 1: 0 2: 2 3: 13 4: 174 |
||
| Right | 1009219751 | 6:60969150-60969172 | CCAGAATCTTGAAGGAGTTTAGG | No data | ||||
| 1009219748_1009219749 | 14 | Left | 1009219748 | 6:60969105-60969127 | CCATGGAGAATAGAAACTACTAC | 0: 1 1: 0 2: 2 3: 13 4: 174 |
||
| Right | 1009219749 | 6:60969142-60969164 | ACTATATGCCAGAATCTTGAAGG | No data | ||||
| 1009219748_1009219752 | 28 | Left | 1009219748 | 6:60969105-60969127 | CCATGGAGAATAGAAACTACTAC | 0: 1 1: 0 2: 2 3: 13 4: 174 |
||
| Right | 1009219752 | 6:60969156-60969178 | TCTTGAAGGAGTTTAGGAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1009219748 | Original CRISPR | GTAGTAGTTTCTATTCTCCA TGG (reversed) | Intergenic | ||