ID: 1009219748

View in Genome Browser
Species Human (GRCh38)
Location 6:60969105-60969127
Sequence GTAGTAGTTTCTATTCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009219748_1009219751 22 Left 1009219748 6:60969105-60969127 CCATGGAGAATAGAAACTACTAC No data
Right 1009219751 6:60969150-60969172 CCAGAATCTTGAAGGAGTTTAGG No data
1009219748_1009219752 28 Left 1009219748 6:60969105-60969127 CCATGGAGAATAGAAACTACTAC No data
Right 1009219752 6:60969156-60969178 TCTTGAAGGAGTTTAGGAAATGG No data
1009219748_1009219749 14 Left 1009219748 6:60969105-60969127 CCATGGAGAATAGAAACTACTAC No data
Right 1009219749 6:60969142-60969164 ACTATATGCCAGAATCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009219748 Original CRISPR GTAGTAGTTTCTATTCTCCA TGG (reversed) Intergenic