ID: 1009219752

View in Genome Browser
Species Human (GRCh38)
Location 6:60969156-60969178
Sequence TCTTGAAGGAGTTTAGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009219748_1009219752 28 Left 1009219748 6:60969105-60969127 CCATGGAGAATAGAAACTACTAC No data
Right 1009219752 6:60969156-60969178 TCTTGAAGGAGTTTAGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009219752 Original CRISPR TCTTGAAGGAGTTTAGGAAA TGG Intergenic