ID: 1009221805

View in Genome Browser
Species Human (GRCh38)
Location 6:60992226-60992248
Sequence ACACTTTCCCAGGCACCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009221801_1009221805 -8 Left 1009221801 6:60992211-60992233 CCAGTCCCTTCATTCACACTTTC No data
Right 1009221805 6:60992226-60992248 ACACTTTCCCAGGCACCATCTGG No data
1009221798_1009221805 24 Left 1009221798 6:60992179-60992201 CCCAGAGGTCTGTGGCAAGAGTG No data
Right 1009221805 6:60992226-60992248 ACACTTTCCCAGGCACCATCTGG No data
1009221799_1009221805 23 Left 1009221799 6:60992180-60992202 CCAGAGGTCTGTGGCAAGAGTGA No data
Right 1009221805 6:60992226-60992248 ACACTTTCCCAGGCACCATCTGG No data
1009221800_1009221805 -5 Left 1009221800 6:60992208-60992230 CCTCCAGTCCCTTCATTCACACT No data
Right 1009221805 6:60992226-60992248 ACACTTTCCCAGGCACCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009221805 Original CRISPR ACACTTTCCCAGGCACCATC TGG Intergenic
No off target data available for this crispr