ID: 1009223001

View in Genome Browser
Species Human (GRCh38)
Location 6:61000862-61000884
Sequence GTGTACACACCCTTCCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009223001_1009223007 30 Left 1009223001 6:61000862-61000884 CCAATATGGAAGGGTGTGTACAC No data
Right 1009223007 6:61000915-61000937 TCTCGCCCTGTCGCCCAGGCTGG 0: 493
1: 29708
2: 96519
3: 203251
4: 237475
1009223001_1009223006 26 Left 1009223001 6:61000862-61000884 CCAATATGGAAGGGTGTGTACAC No data
Right 1009223006 6:61000911-61000933 AGAGTCTCGCCCTGTCGCCCAGG 0: 134
1: 6855
2: 53542
3: 130492
4: 189133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009223001 Original CRISPR GTGTACACACCCTTCCATAT TGG (reversed) Intergenic
No off target data available for this crispr