ID: 1009223412

View in Genome Browser
Species Human (GRCh38)
Location 6:61003143-61003165
Sequence CATAATATGCAGAGGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009223408_1009223412 -8 Left 1009223408 6:61003128-61003150 CCCTGTGATATGGTTCATAATAT No data
Right 1009223412 6:61003143-61003165 CATAATATGCAGAGGGAAAGAGG No data
1009223405_1009223412 16 Left 1009223405 6:61003104-61003126 CCATATAGCGGGGATCATACACA No data
Right 1009223412 6:61003143-61003165 CATAATATGCAGAGGGAAAGAGG No data
1009223407_1009223412 -7 Left 1009223407 6:61003127-61003149 CCCCTGTGATATGGTTCATAATA No data
Right 1009223412 6:61003143-61003165 CATAATATGCAGAGGGAAAGAGG No data
1009223409_1009223412 -9 Left 1009223409 6:61003129-61003151 CCTGTGATATGGTTCATAATATG No data
Right 1009223412 6:61003143-61003165 CATAATATGCAGAGGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009223412 Original CRISPR CATAATATGCAGAGGGAAAG AGG Intergenic
No off target data available for this crispr