ID: 1009225464

View in Genome Browser
Species Human (GRCh38)
Location 6:61016774-61016796
Sequence CCTAATATTTAGAAGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009225464_1009225468 -8 Left 1009225464 6:61016774-61016796 CCACTCTCCTTCTAAATATTAGG No data
Right 1009225468 6:61016789-61016811 ATATTAGGAACAATATCACAGGG No data
1009225464_1009225467 -9 Left 1009225464 6:61016774-61016796 CCACTCTCCTTCTAAATATTAGG No data
Right 1009225467 6:61016788-61016810 AATATTAGGAACAATATCACAGG No data
1009225464_1009225470 -4 Left 1009225464 6:61016774-61016796 CCACTCTCCTTCTAAATATTAGG No data
Right 1009225470 6:61016793-61016815 TAGGAACAATATCACAGGGAGGG No data
1009225464_1009225471 18 Left 1009225464 6:61016774-61016796 CCACTCTCCTTCTAAATATTAGG No data
Right 1009225471 6:61016815-61016837 GTGTACACCCCCTGTGATAATGG No data
1009225464_1009225472 19 Left 1009225464 6:61016774-61016796 CCACTCTCCTTCTAAATATTAGG No data
Right 1009225472 6:61016816-61016838 TGTACACCCCCTGTGATAATGGG No data
1009225464_1009225469 -5 Left 1009225464 6:61016774-61016796 CCACTCTCCTTCTAAATATTAGG No data
Right 1009225469 6:61016792-61016814 TTAGGAACAATATCACAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009225464 Original CRISPR CCTAATATTTAGAAGGAGAG TGG (reversed) Intergenic
No off target data available for this crispr