ID: 1009228424

View in Genome Browser
Species Human (GRCh38)
Location 6:61037776-61037798
Sequence GGGGAACTATATCACGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009228408_1009228424 25 Left 1009228408 6:61037728-61037750 CCTGCATTATTGAGAGTAATATT No data
Right 1009228424 6:61037776-61037798 GGGGAACTATATCACGGGGAGGG No data
1009228414_1009228424 -6 Left 1009228414 6:61037759-61037781 CCTGTCCCCCCGGATATGGGGAA No data
Right 1009228424 6:61037776-61037798 GGGGAACTATATCACGGGGAGGG No data
1009228413_1009228424 -5 Left 1009228413 6:61037758-61037780 CCCTGTCCCCCCGGATATGGGGA No data
Right 1009228424 6:61037776-61037798 GGGGAACTATATCACGGGGAGGG No data
1009228407_1009228424 28 Left 1009228407 6:61037725-61037747 CCACCTGCATTATTGAGAGTAAT No data
Right 1009228424 6:61037776-61037798 GGGGAACTATATCACGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009228424 Original CRISPR GGGGAACTATATCACGGGGA GGG Intergenic
No off target data available for this crispr