ID: 1009231079

View in Genome Browser
Species Human (GRCh38)
Location 6:61061831-61061853
Sequence GTGGAATGAATGAGTTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009231079_1009231080 -10 Left 1009231079 6:61061831-61061853 CCTCTCAAACTCATTCATTCCAC No data
Right 1009231080 6:61061844-61061866 TTCATTCCACTTCAACCACATGG No data
1009231079_1009231081 -9 Left 1009231079 6:61061831-61061853 CCTCTCAAACTCATTCATTCCAC No data
Right 1009231081 6:61061845-61061867 TCATTCCACTTCAACCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009231079 Original CRISPR GTGGAATGAATGAGTTTGAG AGG (reversed) Intergenic
No off target data available for this crispr