ID: 1009232302

View in Genome Browser
Species Human (GRCh38)
Location 6:61078101-61078123
Sequence CTTGTAAGACGGATCTGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009232298_1009232302 -10 Left 1009232298 6:61078088-61078110 CCCTTTAGCATTTCTTGTAAGAC 0: 51
1: 399
2: 772
3: 1130
4: 1653
Right 1009232302 6:61078101-61078123 CTTGTAAGACGGATCTGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009232302 Original CRISPR CTTGTAAGACGGATCTGATA GGG Intergenic
No off target data available for this crispr