ID: 1009241711

View in Genome Browser
Species Human (GRCh38)
Location 6:61193459-61193481
Sequence CTCCCCCTTTAGGCCTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009241711_1009241718 9 Left 1009241711 6:61193459-61193481 CCATCCCAGGCCTAAAGGGGGAG No data
Right 1009241718 6:61193491-61193513 GGACCCACCCCTTTCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009241711 Original CRISPR CTCCCCCTTTAGGCCTGGGA TGG (reversed) Intergenic