ID: 1009241718

View in Genome Browser
Species Human (GRCh38)
Location 6:61193491-61193513
Sequence GGACCCACCCCTTTCCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009241703_1009241718 23 Left 1009241703 6:61193445-61193467 CCCCAGGCTTCAGGCCATCCCAG No data
Right 1009241718 6:61193491-61193513 GGACCCACCCCTTTCCATCCAGG No data
1009241701_1009241718 29 Left 1009241701 6:61193439-61193461 CCTGGCCCCCAGGCTTCAGGCCA No data
Right 1009241718 6:61193491-61193513 GGACCCACCCCTTTCCATCCAGG No data
1009241713_1009241718 4 Left 1009241713 6:61193464-61193486 CCAGGCCTAAAGGGGGAGCTTCA No data
Right 1009241718 6:61193491-61193513 GGACCCACCCCTTTCCATCCAGG No data
1009241702_1009241718 24 Left 1009241702 6:61193444-61193466 CCCCCAGGCTTCAGGCCATCCCA No data
Right 1009241718 6:61193491-61193513 GGACCCACCCCTTTCCATCCAGG No data
1009241711_1009241718 9 Left 1009241711 6:61193459-61193481 CCATCCCAGGCCTAAAGGGGGAG No data
Right 1009241718 6:61193491-61193513 GGACCCACCCCTTTCCATCCAGG No data
1009241704_1009241718 22 Left 1009241704 6:61193446-61193468 CCCAGGCTTCAGGCCATCCCAGG No data
Right 1009241718 6:61193491-61193513 GGACCCACCCCTTTCCATCCAGG No data
1009241715_1009241718 -1 Left 1009241715 6:61193469-61193491 CCTAAAGGGGGAGCTTCACTGGG No data
Right 1009241718 6:61193491-61193513 GGACCCACCCCTTTCCATCCAGG No data
1009241706_1009241718 21 Left 1009241706 6:61193447-61193469 CCAGGCTTCAGGCCATCCCAGGC No data
Right 1009241718 6:61193491-61193513 GGACCCACCCCTTTCCATCCAGG No data
1009241712_1009241718 5 Left 1009241712 6:61193463-61193485 CCCAGGCCTAAAGGGGGAGCTTC No data
Right 1009241718 6:61193491-61193513 GGACCCACCCCTTTCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009241718 Original CRISPR GGACCCACCCCTTTCCATCC AGG Intergenic