ID: 1009242311

View in Genome Browser
Species Human (GRCh38)
Location 6:61197686-61197708
Sequence CTAGTCCTTCCCACCACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009242311_1009242315 4 Left 1009242311 6:61197686-61197708 CCATGTGTGGTGGGAAGGACTAG No data
Right 1009242315 6:61197713-61197735 AGATAACTGTTTCATGGCAGTGG No data
1009242311_1009242314 -2 Left 1009242311 6:61197686-61197708 CCATGTGTGGTGGGAAGGACTAG No data
Right 1009242314 6:61197707-61197729 AGGTGGAGATAACTGTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009242311 Original CRISPR CTAGTCCTTCCCACCACACA TGG (reversed) Intergenic
No off target data available for this crispr