ID: 1009244085

View in Genome Browser
Species Human (GRCh38)
Location 6:61213631-61213653
Sequence TAAAATCTGGTTGAGATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009244085_1009244089 -3 Left 1009244085 6:61213631-61213653 CCTTAGATCTCAACCAGATTTTA No data
Right 1009244089 6:61213651-61213673 TTAGCAGATTAGGGATTCTCTGG No data
1009244085_1009244092 2 Left 1009244085 6:61213631-61213653 CCTTAGATCTCAACCAGATTTTA No data
Right 1009244092 6:61213656-61213678 AGATTAGGGATTCTCTGGAGGGG No data
1009244085_1009244093 14 Left 1009244085 6:61213631-61213653 CCTTAGATCTCAACCAGATTTTA No data
Right 1009244093 6:61213668-61213690 CTCTGGAGGGGAATGCTCCCAGG No data
1009244085_1009244091 1 Left 1009244085 6:61213631-61213653 CCTTAGATCTCAACCAGATTTTA No data
Right 1009244091 6:61213655-61213677 CAGATTAGGGATTCTCTGGAGGG No data
1009244085_1009244090 0 Left 1009244085 6:61213631-61213653 CCTTAGATCTCAACCAGATTTTA No data
Right 1009244090 6:61213654-61213676 GCAGATTAGGGATTCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009244085 Original CRISPR TAAAATCTGGTTGAGATCTA AGG (reversed) Intergenic
No off target data available for this crispr