ID: 1009244093

View in Genome Browser
Species Human (GRCh38)
Location 6:61213668-61213690
Sequence CTCTGGAGGGGAATGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009244088_1009244093 1 Left 1009244088 6:61213644-61213666 CCAGATTTTAGCAGATTAGGGAT No data
Right 1009244093 6:61213668-61213690 CTCTGGAGGGGAATGCTCCCAGG No data
1009244085_1009244093 14 Left 1009244085 6:61213631-61213653 CCTTAGATCTCAACCAGATTTTA No data
Right 1009244093 6:61213668-61213690 CTCTGGAGGGGAATGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009244093 Original CRISPR CTCTGGAGGGGAATGCTCCC AGG Intergenic
No off target data available for this crispr