ID: 1009245293

View in Genome Browser
Species Human (GRCh38)
Location 6:61230517-61230539
Sequence CTGAGTTAGCATTATGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009245290_1009245293 28 Left 1009245290 6:61230466-61230488 CCCGTGAACTTGTCAAAAAAAAT No data
Right 1009245293 6:61230517-61230539 CTGAGTTAGCATTATGAGTTGGG No data
1009245291_1009245293 27 Left 1009245291 6:61230467-61230489 CCGTGAACTTGTCAAAAAAAATC No data
Right 1009245293 6:61230517-61230539 CTGAGTTAGCATTATGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009245293 Original CRISPR CTGAGTTAGCATTATGAGTT GGG Intergenic
No off target data available for this crispr