ID: 1009248364

View in Genome Browser
Species Human (GRCh38)
Location 6:61268694-61268716
Sequence CTTGTGAGATATGGTGTTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009248364_1009248368 17 Left 1009248364 6:61268694-61268716 CCGGAAACACCATATCTCACAAG No data
Right 1009248368 6:61268734-61268756 GAGGACAGCACTAAGGCACGAGG No data
1009248364_1009248366 -2 Left 1009248364 6:61268694-61268716 CCGGAAACACCATATCTCACAAG No data
Right 1009248366 6:61268715-61268737 AGATCTCACTCACTATTAAGAGG No data
1009248364_1009248367 10 Left 1009248364 6:61268694-61268716 CCGGAAACACCATATCTCACAAG No data
Right 1009248367 6:61268727-61268749 CTATTAAGAGGACAGCACTAAGG No data
1009248364_1009248369 18 Left 1009248364 6:61268694-61268716 CCGGAAACACCATATCTCACAAG No data
Right 1009248369 6:61268735-61268757 AGGACAGCACTAAGGCACGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009248364 Original CRISPR CTTGTGAGATATGGTGTTTC CGG (reversed) Intergenic
No off target data available for this crispr