ID: 1009259354

View in Genome Browser
Species Human (GRCh38)
Location 6:61464264-61464286
Sequence CAGGATAAACACTAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009259349_1009259354 1 Left 1009259349 6:61464240-61464262 CCAATGGCAAAAAAGCTAATATC No data
Right 1009259354 6:61464264-61464286 CAGGATAAACACTAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009259354 Original CRISPR CAGGATAAACACTAGAAGGA AGG Intergenic
No off target data available for this crispr