ID: 1009260043

View in Genome Browser
Species Human (GRCh38)
Location 6:61474556-61474578
Sequence CAGGATAAAAAGCAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009260038_1009260043 1 Left 1009260038 6:61474532-61474554 CCAATGGTGAGAAAACAAATATC No data
Right 1009260043 6:61474556-61474578 CAGGATAAAAAGCAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009260043 Original CRISPR CAGGATAAAAAGCAGAAGGA AGG Intergenic
No off target data available for this crispr