ID: 1009261787

View in Genome Browser
Species Human (GRCh38)
Location 6:61499982-61500004
Sequence CTGAGAAACCACTTGGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009261787_1009261791 26 Left 1009261787 6:61499982-61500004 CCTATCACCAAGTGGTTTCTCAG No data
Right 1009261791 6:61500031-61500053 GATATTCACTTATTCACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009261787 Original CRISPR CTGAGAAACCACTTGGTGAT AGG (reversed) Intergenic