ID: 1009265100

View in Genome Browser
Species Human (GRCh38)
Location 6:61544544-61544566
Sequence GTTTAACTGGGGAAAGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009265093_1009265100 -9 Left 1009265093 6:61544530-61544552 CCTTTCCCAACTAGGTTTAACTG No data
Right 1009265100 6:61544544-61544566 GTTTAACTGGGGAAAGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009265100 Original CRISPR GTTTAACTGGGGAAAGTGGT AGG Intergenic
No off target data available for this crispr