ID: 1009268602

View in Genome Browser
Species Human (GRCh38)
Location 6:61589444-61589466
Sequence TCAGCAACTAAGTTTAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009268601_1009268602 3 Left 1009268601 6:61589418-61589440 CCTATAGTTAAGAGTAAGTATGT No data
Right 1009268602 6:61589444-61589466 TCAGCAACTAAGTTTAAATAAGG No data
1009268600_1009268602 15 Left 1009268600 6:61589406-61589428 CCTAAATGTCTTCCTATAGTTAA No data
Right 1009268602 6:61589444-61589466 TCAGCAACTAAGTTTAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009268602 Original CRISPR TCAGCAACTAAGTTTAAATA AGG Intergenic
No off target data available for this crispr