ID: 1009281085

View in Genome Browser
Species Human (GRCh38)
Location 6:61752706-61752728
Sequence GAATATGACCTCAATGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009281085 Original CRISPR GAATATGACCTCAATGAGCA TGG (reversed) Intronic
900489012 1:2937043-2937065 GAATCGGACCTTTATGAGCACGG + Intergenic
901227597 1:7623171-7623193 GACTCTGCCCTCAAAGAGCATGG - Intronic
902815709 1:18915420-18915442 TAATATGACATCACTGAGCCTGG + Intronic
904876749 1:33661036-33661058 GAATAGGACTTCCATGAGCTGGG + Intronic
905036384 1:34920818-34920840 GAATATAAACTTCATGAGCATGG - Intronic
906681380 1:47728006-47728028 GAATAAGACCAGAGTGAGCAGGG - Intergenic
908150168 1:61292512-61292534 GAATATGTACTCAAGGAGTATGG - Intronic
912444617 1:109725675-109725697 GTAGATAACCTCAAGGAGCACGG - Intronic
916326558 1:163566866-163566888 GATTATGACCTTAATGAAAAAGG - Intergenic
917260790 1:173165850-173165872 GAATAATACTTCAATGACCATGG + Intergenic
917939494 1:179904177-179904199 GAATAATAACTCAATAAGCAAGG - Intronic
918220775 1:182434431-182434453 CCATATTACCTTAATGAGCAGGG - Intergenic
920396130 1:205647480-205647502 GAAGATGGCCTCTATGAGCCAGG - Intergenic
920733938 1:208514032-208514054 CAATATGACCTCACTGACCATGG - Intergenic
921001279 1:211046162-211046184 GAATAATACTGCAATGAGCATGG + Intronic
922060243 1:222082348-222082370 GAATTTAAGCTCAAAGAGCAGGG - Intergenic
923401279 1:233617615-233617637 GGATATGATCTGACTGAGCACGG + Intronic
923901673 1:238332914-238332936 GCCAATGACCTCAATGAGCTTGG - Intergenic
1064270319 10:13859473-13859495 GAATATAAGCTCCATGAGGATGG - Intronic
1064826362 10:19407090-19407112 GAATCTGGCTTCTATGAGCATGG + Intronic
1066451640 10:35535312-35535334 GTAGATAACCTCAAGGAGCACGG + Intronic
1067327002 10:45279040-45279062 GCAGATAACCTCAAGGAGCATGG - Intergenic
1068630917 10:59296756-59296778 GAAGATGCTCACAATGAGCATGG - Intronic
1069077021 10:64048851-64048873 GAATAGTACCACAATGAACATGG - Intergenic
1070087775 10:73253293-73253315 GAATATGACCTCGGTGATGAGGG + Intergenic
1072022851 10:91421079-91421101 GAAAATGAAAGCAATGAGCAAGG - Intronic
1075121719 10:119669478-119669500 GAAGATGAGCTCCAGGAGCAGGG - Intronic
1076730227 10:132435504-132435526 GTATATGACCTCTATGTACACGG + Intergenic
1077113789 11:873610-873632 GAATAAGGACTCAATGAACACGG + Intronic
1078519611 11:12052656-12052678 AAATATGAGCTCCATGAGGAAGG - Intergenic
1079505697 11:21149762-21149784 GAATATAAGCTCCATGAGAACGG - Intronic
1081311470 11:41579176-41579198 GAATATATCCTCCATGAGTAAGG + Intergenic
1082909066 11:58349342-58349364 GAATATGTCCCCAATGCGGAGGG + Intergenic
1087487824 11:98780151-98780173 GAATAATGCCACAATGAGCATGG - Intergenic
1087825898 11:102764432-102764454 GAATATAACCTGAATGAGCTTGG - Intergenic
1088006135 11:104942823-104942845 GAATATAATCTCAATGAAAATGG - Intergenic
1090109713 11:123893540-123893562 AAATGTGACCTGAATAAGCATGG - Intergenic
1090888485 11:130900715-130900737 GTAAATGACCTCAAGGAGAAGGG + Intronic
1091693612 12:2613131-2613153 GGATATCTCCTCAATGAACATGG - Intronic
1093803801 12:23407605-23407627 GAATAATACTTCAATGAACATGG - Intergenic
1094618075 12:32054344-32054366 GTAGATAACCTCAAGGAGCACGG - Intergenic
1095166503 12:38979770-38979792 GGATATGCCTTCAATCAGCATGG - Intergenic
1095362301 12:41357516-41357538 AAAGATGAACACAATGAGCATGG + Intronic
1096112440 12:49037597-49037619 CAACAGGTCCTCAATGAGCAGGG + Exonic
1096820654 12:54231496-54231518 GAATGTGACCGCAAGGAGCCAGG + Exonic
1100122092 12:91380555-91380577 GAATATGACCTCATTTGCCATGG - Intergenic
1102307495 12:111816417-111816439 GTAGATAACCTCAAAGAGCATGG + Intergenic
1105225328 13:18426401-18426423 GAATATGAGCTGATTGAGCCTGG - Intergenic
1105864935 13:24451125-24451147 GAATAGGCCCTCACTGAGGAAGG + Intronic
1106594754 13:31126554-31126576 GAATATGACCTCATTTGGAAAGG + Intergenic
1108692224 13:52869874-52869896 GAAAATGACCTCACTGATCCTGG - Intergenic
1111039607 13:82729468-82729490 GAATAAGACTGCAATGAACACGG + Intergenic
1112559340 13:100498481-100498503 GAATTTTAACTCAAGGAGCAAGG - Intronic
1113010511 13:105759817-105759839 GAAAATGACTTCAATGAACTTGG + Intergenic
1114009796 14:18354749-18354771 GAATATGAGCTGATTGAGCCTGG - Intergenic
1114431984 14:22669702-22669724 GGATATGCCCAGAATGAGCAAGG - Intergenic
1114622856 14:24108118-24108140 GGAAATGAACACAATGAGCATGG - Intronic
1114821508 14:26025577-26025599 CAATTTCACCTCAATGAGCCTGG + Intergenic
1117657338 14:57969830-57969852 GACTATGAAGTCACTGAGCACGG + Intronic
1118044761 14:61955730-61955752 GAATAATACTTCAATGAACATGG + Intergenic
1118930732 14:70237935-70237957 GCAGATAACCTCAAGGAGCATGG - Intergenic
1119100141 14:71871947-71871969 GAATTTGAGCTCAATGTGTATGG + Intergenic
1119589644 14:75873758-75873780 GAATAATACATCAATGAACACGG + Intronic
1119959531 14:78838946-78838968 GCAAATAACCTAAATGAGCAAGG - Intronic
1120399458 14:84010586-84010608 TAATATGTGCTCAATGAACATGG - Intergenic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1126184214 15:45815136-45815158 GTAGATAACCTCAAGGAGCATGG - Intergenic
1126231778 15:46335271-46335293 GAATAGGACATAAATCAGCAAGG - Intergenic
1126928633 15:53621486-53621508 GAATATGACCTGGATGAGATTGG + Intronic
1128514010 15:68331029-68331051 CAATTGGACCTCAATGAGGATGG - Exonic
1134377684 16:13693157-13693179 GTAGATAACCTCAAGGAGCATGG + Intergenic
1134864609 16:17593558-17593580 GAACAGGACCTCACTAAGCAAGG - Intergenic
1138601189 16:58055630-58055652 GAATGTGACCTCAGTAAGGAGGG - Intergenic
1146012983 17:29210520-29210542 CAATGTGACATCACTGAGCATGG - Intergenic
1146937000 17:36818249-36818271 GAACATGCCCTCCATGGGCATGG - Intergenic
1154528043 18:15313120-15313142 GAATATGAGCTGATTGAGCCTGG + Intergenic
1155502751 18:26503663-26503685 GACTGTGACCTCATTCAGCATGG + Intronic
1158797295 18:60862466-60862488 GAATAATGCTTCAATGAGCATGG - Intergenic
1159746823 18:72246589-72246611 GAATTTGATCTCTATTAGCAAGG - Intergenic
1163383076 19:16981438-16981460 GGATATGAACTCAATGAGTTGGG + Intronic
1164278664 19:23748401-23748423 GTAGATAACCTCAAGGAGCATGG - Intronic
1166027611 19:40102768-40102790 AAATAAGACCTAAATCAGCAAGG + Intergenic
1166594607 19:44034461-44034483 GTAGATAACCTCAAGGAGCACGG + Intergenic
1167819480 19:51913443-51913465 GTAGATAACCTCAAGGAGCATGG - Intronic
1167838038 19:52090893-52090915 GTAGATAACCTCAAGGAGCATGG - Intronic
1167855066 19:52230573-52230595 GAATCTCACCTCCAGGAGCATGG + Intergenic
1168679739 19:58305830-58305852 GTAGATAACCTCAAGGAGCAGGG - Intronic
928472767 2:31590292-31590314 GATTATATCCTCCATGAGCATGG + Intergenic
929230285 2:39552642-39552664 GAATAAGGCTACAATGAGCATGG + Intergenic
930976100 2:57463572-57463594 GAATATTGCCACAATGAACATGG + Intergenic
931771043 2:65498492-65498514 GAATAATGCTTCAATGAGCATGG + Intergenic
935689316 2:105716027-105716049 GAATAGGAACTCATTGAGAAGGG - Intergenic
938527146 2:132144579-132144601 GAATATGAGCTGATTGAGCCTGG + Intergenic
938938575 2:136148838-136148860 GAATATGCTCCCAGTGAGCAGGG + Intergenic
940405918 2:153301987-153302009 GAATAAGACTGCAATGAACATGG + Intergenic
942314885 2:174689181-174689203 TAAGATGACCTCAATCACCAGGG - Intergenic
943966517 2:194341004-194341026 GAATATGAAGTCAATAAACAGGG - Intergenic
945889104 2:215409583-215409605 GAATATGAGCTGAGTGAGGAGGG - Exonic
947133138 2:226950482-226950504 GAATAATGCCTCAATGAACATGG + Intronic
1168905102 20:1396955-1396977 GTAGATAATCTCAATGAGCATGG - Intergenic
1168905757 20:1402422-1402444 GTAGACAACCTCAATGAGCATGG - Intergenic
1168912205 20:1457866-1457888 GAAGAGCACCGCAATGAGCACGG + Intronic
1170868374 20:20181425-20181447 GACTTTGACCTCAAGGATCAGGG - Intronic
1171293713 20:23998204-23998226 GAAAATGACTTCAAGGATCATGG - Intergenic
1172176720 20:32976904-32976926 GTAGATAACCTCAATGAGCACGG + Intergenic
1173273785 20:41560361-41560383 GAATAAGACCTGAATGAGCAGGG - Intronic
1173356153 20:42292643-42292665 GCATCTGACCTCAATGACAAAGG - Intronic
1173823787 20:46034705-46034727 GAATAGGACCCCCAAGAGCAAGG + Intronic
1176338542 21:5621513-5621535 AAATTTGAACTCAATGAACATGG - Intergenic
1176339950 21:5684586-5684608 AAATTTGAACTCAATGAACATGG - Intergenic
1176472204 21:7116739-7116761 AAATTTGAACTCAATGAACATGG - Intergenic
1176495765 21:7498517-7498539 AAATTTGAACTCAATGAACATGG - Intergenic
1176504877 21:7639870-7639892 AAATTTGAACTCAATGAACATGG + Intergenic
1176769383 21:13055424-13055446 GAATATGAGCTGATTGAGCCTGG - Intergenic
1178598266 21:33974178-33974200 AAAAATGAACTCAATGATCATGG - Intergenic
1180434296 22:15285558-15285580 GAATATGAGCTGATTGAGCCTGG - Intergenic
1180516483 22:16149368-16149390 GAATATGAGCTGATTGAGCCTGG - Intergenic
1183536976 22:38408316-38408338 GAATAAAACTGCAATGAGCATGG - Intergenic
1183820671 22:40343675-40343697 GAGTTTGCCATCAATGAGCAAGG + Intergenic
1184643507 22:45884375-45884397 GCCTCTGACCTCAGTGAGCATGG + Intergenic
949390946 3:3561598-3561620 GCCTATAACCTAAATGAGCAAGG - Intergenic
950004206 3:9681091-9681113 GAATATGACCTCAACAATCATGG - Intronic
951228633 3:20150133-20150155 GAAACTGACCTAATTGAGCAAGG + Intronic
953712101 3:45282403-45282425 GAATAGGACTGCAATAAGCATGG - Intergenic
954858238 3:53664995-53665017 GTAGATAACCTCAATGAGCACGG + Intronic
956223181 3:66925477-66925499 GAAAAGGACATTAATGAGCAAGG + Intergenic
957459815 3:80501749-80501771 GAACATGACCACAGTGTGCATGG - Intergenic
957646309 3:82934102-82934124 GAATAATACTTCAATGAGCATGG + Intergenic
957861781 3:85961626-85961648 GAATATGTTCTCATTGTGCATGG + Exonic
958846871 3:99275367-99275389 GAATAAGGCTTCAATGGGCATGG + Intergenic
960114115 3:113876182-113876204 GAATATAACCTTCATGACCAAGG + Exonic
960487985 3:118276614-118276636 GAATATGTTATCAATGAGCTTGG + Intergenic
961516436 3:127440295-127440317 GAATATAAACTCTATGATCAAGG + Intergenic
962343625 3:134604635-134604657 CAATATGACTTCACTGAGCATGG + Intronic
963606452 3:147415606-147415628 GAAACTGACCTCACTGGGCAAGG + Exonic
964611595 3:158621457-158621479 GTAGATAACCTCAAGGAGCATGG + Intergenic
964847990 3:161064453-161064475 GAATATGACCTTAATGAGGAAGG + Intronic
965915486 3:173841508-173841530 TAATATTCCCTCCATGAGCAAGG + Intronic
967280872 3:187822427-187822449 GAATAGCACCTCAGAGAGCAGGG + Intergenic
967368207 3:188712124-188712146 GCATGTGATCTCAATGTGCAAGG - Intronic
967813175 3:193777465-193777487 GAATATGACCTGAATCAGCTAGG - Intergenic
973045174 4:45528057-45528079 GAATATAAGGTCAATGATCATGG + Intergenic
975277845 4:72522457-72522479 GAATGTGTCCTCAACAAGCAAGG - Intronic
975429738 4:74274749-74274771 TAATGTGACCTCACTGAACATGG - Intronic
975737171 4:77392518-77392540 GTAGATAACCTCAAGGAGCATGG + Intronic
978322257 4:107510598-107510620 GAATTTGACCTCATTTAGAAAGG + Intergenic
978386530 4:108181195-108181217 GAATGTAAACTCTATGAGCAGGG + Intergenic
978493065 4:109329485-109329507 GAATATGACCTTAAGGGGAATGG + Intergenic
978642692 4:110890412-110890434 GAATTTGAACTCAAGTAGCAAGG + Intergenic
981159240 4:141477029-141477051 GAATAGTGCTTCAATGAGCATGG + Intergenic
981836440 4:149059877-149059899 GAATAGTACTGCAATGAGCATGG + Intergenic
982793538 4:159619665-159619687 GAATCTGCCCTCAATGAGTTTGG + Intergenic
984076739 4:175191098-175191120 GAATAGCACCACAATGAACATGG - Intergenic
984076742 4:175191147-175191169 GAATAGCACCACAATGAACATGG - Intergenic
991662253 5:68962186-68962208 GAATATCAACCCAATGAGAATGG + Intergenic
991699685 5:69305645-69305667 GTAGATAACCTCAAGGAGCACGG - Intronic
992548580 5:77840011-77840033 CAATTTGACCTCAGTGAACAAGG + Intronic
993444496 5:87994687-87994709 GAAAATGACCTTAATGCCCAAGG + Intergenic
993613663 5:90084532-90084554 GAATATAAACTCAGTGAGCCTGG + Intergenic
994404397 5:99325828-99325850 GAATAATACTTCAATGAGCATGG - Intergenic
1000047398 5:157533025-157533047 GAATATGGCCTCAAGGCGCCTGG + Intronic
1000805707 5:165788933-165788955 GAATATGGCTTCAATAAACATGG + Intergenic
1001754863 5:174160450-174160472 GACTCTGACCTCCATGAGGAAGG + Intronic
1001876177 5:175203095-175203117 GAATAAAGCCTCAATGAGCATGG + Intergenic
1006185854 6:32181383-32181405 CAAGATGACCCCAATGAGCAGGG + Exonic
1006664509 6:35682288-35682310 GAATATATTCTGAATGAGCATGG - Intronic
1009281085 6:61752706-61752728 GAATATGACCTCAATGAGCATGG - Intronic
1010907543 6:81510201-81510223 GAATAACACCACAATGACCATGG + Intronic
1011330978 6:86206241-86206263 GTAGATAACCTCAAGGAGCATGG + Intergenic
1013650997 6:112194293-112194315 GCATCTGACCTCTATGAGCTTGG - Intronic
1014460969 6:121695056-121695078 GAATATGACCTACACCAGCAAGG + Intergenic
1014508845 6:122294992-122295014 CCTTATGACCTCACTGAGCAGGG + Intergenic
1016446334 6:144136643-144136665 GAATATGAGCACCTTGAGCAAGG + Intergenic
1016654318 6:146500382-146500404 GTAGATAACCTCAAGGAGCACGG - Intergenic
1019114145 6:169743672-169743694 TAATATGAGCCCACTGAGCAGGG - Intronic
1024183485 7:46923035-46923057 GAATATTGCTGCAATGAGCAAGG + Intergenic
1026160682 7:67866143-67866165 GAGTCTGACCTCCATGAGAAAGG - Intergenic
1027502161 7:78966615-78966637 GAATAATCCCTCAATGACCATGG + Intronic
1028606226 7:92659099-92659121 GAATGAGACTTCAATGAGAAGGG + Intronic
1030253199 7:107473492-107473514 GAATATGAATTCAATCAACATGG + Intronic
1032064338 7:128754383-128754405 GGGCATGACCTCAATGAGGACGG + Intronic
1033089372 7:138371101-138371123 GAGGATGACCTCACTGAGCTGGG - Intergenic
1036011180 8:4726493-4726515 AAATAAGACCTCAATGGACAGGG + Intronic
1038830163 8:31048578-31048600 GTATAAAACCTCAATGTGCAAGG + Intronic
1039598891 8:38816846-38816868 GAAAATGAGCTCAATCACCAAGG - Intronic
1039735167 8:40323931-40323953 GAACATGACCTACATGTGCATGG + Intergenic
1040706207 8:50131624-50131646 GAATAATGCCTCAATGAACATGG + Intronic
1045443982 8:102241300-102241322 AGATAAGACCTGAATGAGCATGG + Intergenic
1045707946 8:104948277-104948299 GAATATGTACACAATGAGCTAGG + Intronic
1046317232 8:112520393-112520415 GAATTTGAACTCAACCAGCAGGG + Intronic
1047311818 8:123698404-123698426 GCACAGGACCTCAATGAGGACGG + Exonic
1047546783 8:125825929-125825951 GACTCAGACCTAAATGAGCATGG - Intergenic
1048530363 8:135242654-135242676 GAATTTGACCTCCATCAGCTGGG + Intergenic
1052415685 9:28173956-28173978 GGATATAACCTCACTGAGCTTGG - Intronic
1053705835 9:40751912-40751934 GAATATGAGCTGATTGAGCCTGG + Intergenic
1054415912 9:64875516-64875538 GAATATGAGCTGATTGAGCCTGG + Intergenic
1059873895 9:118610561-118610583 GACTATAAACTCAATGAGAACGG - Intergenic
1203423117 Un_GL000195v1:13407-13429 AAATTTGAACTCAATGAACATGG + Intergenic
1188762093 X:34045086-34045108 GAATAATACCACAATGAACATGG - Intergenic
1189023328 X:37365323-37365345 GTAGATAACCTCAAGGAGCATGG + Intronic
1192288432 X:69764155-69764177 GGATAAGAGATCAATGAGCAAGG - Intronic
1194361000 X:92950426-92950448 GAATATTCCCTCAATGCCCAAGG + Intergenic
1195152635 X:102088006-102088028 GTATTTGACCCCAATCAGCATGG - Intergenic
1196636991 X:118013500-118013522 AAACATGACTTCAATGAGCCAGG + Intronic
1197682312 X:129399235-129399257 GAATATCACTGCAATGAACATGG - Intergenic
1197707571 X:129645778-129645800 GAACATGACCTCCAAGAGTAAGG + Intergenic
1199228175 X:145404163-145404185 GAATAATGCTTCAATGAGCACGG - Intergenic
1200326763 X:155248700-155248722 GAATATGACGTATAAGAGCATGG - Intergenic