ID: 1009283332

View in Genome Browser
Species Human (GRCh38)
Location 6:61779293-61779315
Sequence GGGCCATAAAAAATAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009283323_1009283332 20 Left 1009283323 6:61779250-61779272 CCTAACATCTGAAGTCCCTTAAC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1009283332 6:61779293-61779315 GGGCCATAAAAAATAACCCATGG 0: 1
1: 0
2: 1
3: 21
4: 179
1009283325_1009283332 4 Left 1009283325 6:61779266-61779288 CCTTAACTCAGAAATATCCTCCC 0: 1
1: 0
2: 1
3: 19
4: 143
Right 1009283332 6:61779293-61779315 GGGCCATAAAAAATAACCCATGG 0: 1
1: 0
2: 1
3: 21
4: 179
1009283322_1009283332 26 Left 1009283322 6:61779244-61779266 CCACTTCCTAACATCTGAAGTCC 0: 1
1: 0
2: 0
3: 13
4: 198
Right 1009283332 6:61779293-61779315 GGGCCATAAAAAATAACCCATGG 0: 1
1: 0
2: 1
3: 21
4: 179
1009283324_1009283332 5 Left 1009283324 6:61779265-61779287 CCCTTAACTCAGAAATATCCTCC 0: 1
1: 0
2: 1
3: 9
4: 188
Right 1009283332 6:61779293-61779315 GGGCCATAAAAAATAACCCATGG 0: 1
1: 0
2: 1
3: 21
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009283332 Original CRISPR GGGCCATAAAAAATAACCCA TGG Intronic
904708869 1:32413475-32413497 GGCCCACAACAAAGAACCCAAGG + Intergenic
906506420 1:46383186-46383208 GGGCCATGAAGAAGAGCCCAGGG + Intergenic
908518617 1:64918570-64918592 GGGCCAGAAAGAATGACCCAGGG + Intronic
909796747 1:79749039-79749061 GCACTCTAAAAAATAACCCATGG + Intergenic
910350811 1:86295367-86295389 TGGCCATAAAAAATAAGTCAGGG - Intergenic
910526492 1:88184605-88184627 TGGTCATGAAAAATAACCCAGGG - Intergenic
910634517 1:89392460-89392482 TGACCATAAAAAATAGCCCTAGG + Intergenic
912281405 1:108318600-108318622 TGTACATAAAACATAACCCATGG + Intergenic
912838943 1:113021823-113021845 GTGCCAAAAAAGAAAACCCAGGG - Intergenic
917262308 1:173183421-173183443 GGGACATAAGAAATCATCCAGGG + Intergenic
920055775 1:203190339-203190361 GGGGAAAAAAAAATGACCCAAGG + Intergenic
920144092 1:203843013-203843035 GGGGGATAAAAAGTAACCTAAGG - Intronic
923940776 1:238823363-238823385 GAGGCAGAAAAAATAACTCAGGG - Intergenic
1066058165 10:31700390-31700412 GGGCTATCAAAACAAACCCAGGG + Intergenic
1067944703 10:50682544-50682566 GGCCCCTGAAAGATAACCCAGGG - Intergenic
1068500269 10:57834856-57834878 GGGACATAACCAATAGCCCAGGG - Intergenic
1070866204 10:79709415-79709437 GGCCCCTGAAAGATAACCCAGGG - Intronic
1070879998 10:79847546-79847568 GGCCCCTGAAAGATAACCCAGGG - Intronic
1071348429 10:84715506-84715528 GGGTCAGAAAATATAGCCCATGG - Intergenic
1071413964 10:85423727-85423749 GGACCAGATAAAATAACGCAGGG + Intergenic
1071633110 10:87231636-87231658 GGCCCCTGAAAGATAACCCAGGG - Intronic
1071646559 10:87363854-87363876 GGCCCCTGAAAGATAACCCAGGG - Intronic
1072682949 10:97519926-97519948 GGGGCATCAAAAAAGACCCAAGG + Intronic
1073353720 10:102837308-102837330 GGGCCAAAACAAATAAGCTAGGG + Exonic
1077984350 11:7335674-7335696 CAGCCATAAAAAATATTCCATGG - Intronic
1078007908 11:7546454-7546476 GGGCCATAAAACAAGACCCATGG - Intronic
1079881472 11:25932641-25932663 GGGCCAGAAATTTTAACCCATGG - Intergenic
1080006413 11:27412402-27412424 GAACCACAAAAAATAACACAAGG - Intronic
1081113148 11:39161952-39161974 AGGCCACAAAAACTAACCCGGGG + Intergenic
1086977711 11:93155694-93155716 GGATCAGAAAAAATAACCAATGG - Intronic
1087068158 11:94046958-94046980 GGGCATTAACAAATATCCCAAGG + Intronic
1087368384 11:97250140-97250162 GGGGCATAGAAAATAACCACAGG - Intergenic
1087904288 11:103677560-103677582 GTGCCACATAACATAACCCAAGG + Intergenic
1091313835 11:134596744-134596766 GGACAATAAAGAATAACCCTAGG - Intergenic
1093499956 12:19800252-19800274 AGGTCATAAAAAATATCCCAGGG + Intergenic
1093668942 12:21849258-21849280 AGGCCAAAAAAAATCAACCAAGG - Intronic
1094773152 12:33689800-33689822 GGTCCATAAAAAAGAACATAGGG + Intergenic
1096713939 12:53479666-53479688 GAGCCAAAAAAAAAAAACCAGGG - Exonic
1101073266 12:101098863-101098885 GGGCCAAAAAACAAAACACATGG - Intronic
1109306555 13:60647953-60647975 GGGCTATAAATAATAACACCTGG + Intergenic
1111599475 13:90453394-90453416 GGGTCAGGAAAAATAACCAATGG - Intergenic
1112045851 13:95596972-95596994 GGACCATAGAAAACACCCCAGGG - Intronic
1112364966 13:98748768-98748790 GGGTCAAAAAAAAGAACCCAGGG + Intronic
1113203955 13:107895151-107895173 GGGACATAACAGATAGCCCAGGG + Intergenic
1119286644 14:73460133-73460155 GGGCCATGAAACAACACCCAGGG + Intronic
1121038763 14:90728067-90728089 GGGCCACAGAATATACCCCAAGG - Intronic
1121460849 14:94076786-94076808 GGGACAACAAAAAAAACCCAGGG + Intronic
1123484184 15:20670547-20670569 AGGCAATAATAAATAACTCAGGG + Intergenic
1124078647 15:26470574-26470596 TGGCCAAACAAAATTACCCAAGG - Intergenic
1124129932 15:26974445-26974467 GGGCCATAGACAATAACACAGGG + Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1127999485 15:64177415-64177437 AGGCCAAGAAAAATAACACATGG + Intronic
1128019019 15:64373970-64373992 GGGACAGAAAAAAAAACCAAGGG - Intronic
1128925360 15:71650476-71650498 GGGCCAGAGAAAATAAACTAAGG + Intronic
1130514364 15:84614878-84614900 GGCCAACAAAAACTAACCCAGGG - Intronic
1131557224 15:93410280-93410302 GGACATTAAAAAATAAGCCAAGG - Intergenic
1131869495 15:96747140-96747162 GGGTCAGGAAAAAAAACCCATGG + Intergenic
1132670203 16:1099387-1099409 GGGCCATTAAAATTCACCCTGGG - Intergenic
1133477947 16:6141420-6141442 GGTCCCTAACAGATAACCCAGGG - Intronic
1133695757 16:8261010-8261032 GGATCAGAAAAAATAACTCATGG - Intergenic
1134516192 16:14889228-14889250 GGGAGTTAAAAAAAAACCCATGG + Intronic
1134903514 16:17959779-17959801 GGGCCATAAACTTTAATCCAAGG + Intergenic
1136122772 16:28150415-28150437 GAATCATAAAAAATAAGCCAGGG + Intronic
1137443513 16:48516488-48516510 GGGCCATAAAAAACACCTTAAGG + Intergenic
1138093110 16:54192734-54192756 GGGGCTTAAAAATTACCCCAAGG + Intergenic
1138099197 16:54238251-54238273 AGGCCATAAAAAAGACCCTAAGG - Intergenic
1138652849 16:58471698-58471720 GCCCCATAACAAATAACCCTGGG + Intronic
1139164450 16:64549489-64549511 AGGCCAAAAAAAAGAAGCCAAGG + Intergenic
1140572218 16:76120890-76120912 GGATCAGAAAAAATAACCAATGG - Intergenic
1141935959 16:87237825-87237847 GGGCAATAAACAATAACCTCTGG - Intronic
1145804071 17:27713972-27713994 GGGGCATAACCAATAGCCCAGGG - Intergenic
1146310471 17:31764635-31764657 GGGGCATATCAAATAGCCCAGGG - Intergenic
1146875751 17:36409253-36409275 GGGCCAAAAAAAACAACTCTTGG - Intronic
1147063636 17:37903616-37903638 GGGCCAAAAAAAACAACTCTTGG + Intergenic
1147185259 17:38709937-38709959 GGACCACACAAAATAACACATGG - Intronic
1148802716 17:50241969-50241991 GGACCATAAAAAACAGGCCATGG - Intergenic
1151029270 17:70717152-70717174 GTCCCATAAAAAATTACCCATGG + Intergenic
1155950594 18:31907788-31907810 GGGCTATAAATAATAAAACAAGG - Intronic
1156394273 18:36683955-36683977 GGACCATAAAAGGAAACCCAAGG + Intronic
1157590620 18:48834414-48834436 GGGCCATAAAAAGCAGGCCATGG + Intronic
1160300219 18:77671435-77671457 GTGCCATAAAAAATTACAAATGG - Intergenic
1161598270 19:5163768-5163790 GGGACATAAATGATAGCCCAGGG + Intronic
1164691906 19:30217569-30217591 GGGCCCTACAAAATCCCCCAGGG - Intergenic
1166583907 19:43928393-43928415 GGACCAGAAAAAATAACTCATGG + Intronic
925208160 2:2025000-2025022 GGGCAATAAAAACAGACCCACGG - Intronic
928434974 2:31249041-31249063 GGGCCATAAGAATTAAACCCAGG + Intronic
928637448 2:33262262-33262284 GTGCCATAACAAAGAACACATGG - Intronic
929022991 2:37572503-37572525 GAAACATAAAAAATAACACAGGG - Intergenic
929304252 2:40342176-40342198 GGGCCATAAACTAAAACCCTTGG - Intronic
930426017 2:51213601-51213623 GTGCCATCAACATTAACCCAGGG - Intergenic
930926540 2:56824691-56824713 CGGTCATAAAAAATAACTAAAGG + Intergenic
931757653 2:65388452-65388474 GGGCCTTGAAAAATTAGCCAAGG + Intronic
932627876 2:73313443-73313465 GGGATATAAAGAATGACCCATGG + Intergenic
933637265 2:84721812-84721834 GGACCATGAAAAATCACCAAGGG - Intronic
933804503 2:85988447-85988469 GGCCCAGGAAAAATAATCCAAGG - Intergenic
938472367 2:131576340-131576362 TGGCCATAAAAAAACACGCATGG - Intergenic
940589116 2:155697816-155697838 GGATCAGAAAAAATAACCAATGG - Intergenic
944105536 2:196075745-196075767 AGGCAAAAAAAAATAACCCTAGG - Intergenic
944846363 2:203672268-203672290 GGGACAGAAAGAATAACCCAGGG - Intergenic
946826624 2:223685825-223685847 CTTCCATAAAAAATAAACCAGGG + Intergenic
948021499 2:234737245-234737267 TGGCCATAAAAAATTTCCAATGG + Intergenic
948109472 2:235443110-235443132 GGGGGAAAAAAAAGAACCCATGG - Intergenic
948165949 2:235862801-235862823 GAGGCATAAAGAACAACCCAGGG - Intronic
1170209425 20:13833880-13833902 GGCCCATAATAATTAGCCCAAGG - Intergenic
1175217000 20:57396528-57396550 GGCCCTTCAAAAATAACCCAAGG - Intronic
1176963815 21:15189693-15189715 GGGGCAAAAAAAATCACCCCTGG + Intergenic
1179120551 21:38541171-38541193 GGGCAATAAAAAGTATCCTAAGG - Intronic
1180603553 22:17037627-17037649 GAGGCATAAAAAATAACCCTAGG - Intergenic
1181972768 22:26705037-26705059 GGGCCAGGAAAAATAACTAATGG - Intergenic
1182116802 22:27761430-27761452 GGGAAAAAAAAAAAAACCCAAGG + Intronic
951993141 3:28698530-28698552 TGGCCCTAAAAAAATACCCAAGG - Intergenic
952452980 3:33448799-33448821 GGGCCATAACCAATAGCCCAGGG - Intergenic
955189832 3:56750544-56750566 AGGCCATAAAAAAAATCTCATGG - Intronic
956544387 3:70384082-70384104 GGGCTAAAAAAAATTACCCAGGG + Intergenic
957728605 3:84102222-84102244 GCTCCATAAAAAATAACAGAAGG - Intergenic
960269185 3:115656050-115656072 GGGACATAAACAAAAACACAGGG + Intronic
963282867 3:143403896-143403918 GGGCAGAAAAAAATAATCCAAGG - Intronic
964373007 3:156020865-156020887 GGGGCATAAAATATAATCAAAGG - Intergenic
965310579 3:167122667-167122689 GGGTCAGAAAAAATTACACAAGG + Intergenic
967639980 3:191850944-191850966 GGATCAGAAAAAATAACCAATGG + Intergenic
970239815 4:13996781-13996803 GGCACATAAAAAATTAGCCAGGG - Intergenic
970336498 4:15050850-15050872 GGACCTTAAACTATAACCCATGG + Intronic
981813592 4:148803387-148803409 AAGCCATAATATATAACCCAAGG - Intergenic
983092525 4:163521624-163521646 CGGCCATACAAAATAGGCCAGGG + Intergenic
984511234 4:180681289-180681311 ATGCCATAAAGAATATCCCAGGG - Intergenic
984868864 4:184309782-184309804 AGTCCATAAAAAACAAACCATGG - Intergenic
985558055 5:567850-567872 AGGCCATAAACAGGAACCCATGG + Intergenic
986789998 5:11150213-11150235 GGGCAATGGAAAAGAACCCAGGG + Intronic
986830986 5:11578100-11578122 GAGCTATGAAAAATAACACACGG - Intronic
987300953 5:16597779-16597801 GGGCCATTACAAACAACCCCTGG - Intronic
988666753 5:33337466-33337488 GGGCCAAAAATAATAAACCTGGG - Intergenic
989542621 5:42635264-42635286 GGGGGATAAATAATAACCCTAGG - Intronic
990509618 5:56478666-56478688 GGCTTATAAAAAATAACCTAGGG + Intronic
994576297 5:101583742-101583764 GGATCAGAAAAAATAACTCATGG - Intergenic
995490760 5:112689342-112689364 TGCCCATCAAAAATAAGCCAAGG + Intergenic
996072118 5:119143101-119143123 GGACCAGAAAAAATAACTCTCGG + Intronic
998028333 5:138840500-138840522 GGGCCAAAAAGAATAACTGAAGG - Intronic
999967905 5:156829595-156829617 GGATCAGAAAAAATAACTCATGG + Intergenic
1000423263 5:161061383-161061405 GAGCCCTAATCAATAACCCATGG - Intergenic
1002972084 6:2033932-2033954 GAGGCATATAAAAGAACCCATGG + Intronic
1003436656 6:6096061-6096083 GGGCAATAAAAAATAATAAAAGG - Intergenic
1004815664 6:19309525-19309547 AGGAAATTAAAAATAACCCAGGG + Intergenic
1005267107 6:24123639-24123661 TTGCCATATAATATAACCCAAGG + Intergenic
1005892652 6:30153028-30153050 TAGCCATAAATCATAACCCAGGG - Exonic
1009283332 6:61779293-61779315 GGGCCATAAAAAATAACCCATGG + Intronic
1009386003 6:63084629-63084651 GGGACATAACCAATAGCCCAGGG + Intergenic
1010768246 6:79800276-79800298 GGGCCTTAATCAATAACCCCAGG + Intergenic
1012441618 6:99266642-99266664 GGGACATAACCAATAGCCCAGGG + Intergenic
1013299159 6:108786952-108786974 GGGCCAGAACAGATGACCCAGGG + Intergenic
1013813128 6:114066822-114066844 GGGCCATAGAAAATGAACAAGGG - Intronic
1015540203 6:134306117-134306139 GTGCCATAAAAAATAGCACAAGG + Intronic
1015722563 6:136258898-136258920 GGGCAATAAAAATGAACCAAAGG - Exonic
1016117277 6:140302629-140302651 TGGCCAATAAAAACAACCCATGG - Intergenic
1016344876 6:143102592-143102614 GGGTCATAGAACATATCCCAGGG + Intronic
1021967713 7:25937940-25937962 GGATCATAAAAAATAACTAATGG + Intergenic
1025984101 7:66432654-66432676 GTGCAATAAAAAATAAAACATGG - Intergenic
1027791046 7:82639248-82639270 GGGACATAACCAATAGCCCAGGG - Intergenic
1028199796 7:87948154-87948176 GGGAAATACAAAATAAACCAAGG - Intronic
1028495291 7:91454156-91454178 GGGACATAACAAATAGCCCGGGG + Intergenic
1030055798 7:105582938-105582960 CTGCCATAAAGAATAACCCCAGG - Intronic
1032552629 7:132799306-132799328 AGGCCATAAAACACAAGCCATGG + Intronic
1033613504 7:142988347-142988369 GGACCATAGAAAATCACCCAGGG + Intergenic
1033883003 7:145910660-145910682 GGACCAGAAATAATAACCTAGGG + Intergenic
1034836779 7:154359495-154359517 GTGCCATAAAGAATAAGGCAGGG - Intronic
1034950978 7:155297315-155297337 GGGCCCGAAAAAATCACCCAAGG + Intergenic
1035092909 7:156329330-156329352 GGGCCATGGAAAACAGCCCAAGG - Intergenic
1040131229 8:43799019-43799041 GGCACATAAAAAAAAAACCAAGG + Intergenic
1040390844 8:46949345-46949367 GGGACATAAAAATTAACCCATGG - Intergenic
1040796873 8:51297107-51297129 GGGACATAACCAATAACCCGGGG + Intergenic
1041886004 8:62808714-62808736 AGGCAATAAAAAATATCACAAGG + Intronic
1042345318 8:67720700-67720722 CGGCGATATAAAATTACCCAAGG - Intronic
1044001155 8:86883046-86883068 GGACCAGAAAAAATAACTAATGG + Intronic
1044272362 8:90261344-90261366 GGACCAGGAAAAATAACCAACGG + Intergenic
1044544845 8:93448307-93448329 GAGCCAAAAAAAAGAAGCCAGGG + Intergenic
1044602283 8:94017420-94017442 GGGTCATAAAAAATAACAAGTGG - Intergenic
1045858475 8:106790727-106790749 GGGACATAACCAATAGCCCAGGG - Intergenic
1046179312 8:110622315-110622337 GGGTCAGAAAAAATAACTCATGG + Intergenic
1046360233 8:113143827-113143849 GGGCAATATAAAATATCCTATGG + Intronic
1046891969 8:119431952-119431974 GGGCCATAGAAAATAATTCTTGG - Intergenic
1047543228 8:125791015-125791037 GGATCAGAAAAAATAACCAATGG - Intergenic
1048478316 8:134763524-134763546 GTGCTATAAAAAATAAGGCACGG - Intergenic
1050181568 9:2928444-2928466 TGGCCATAAAGAAAACCCCAAGG + Intergenic
1051616331 9:19010380-19010402 GGGAAATAAAAGATAATCCAGGG + Intronic
1052092084 9:24341059-24341081 GGGCCACAAAAAATAATTCAAGG - Intergenic
1055026078 9:71723062-71723084 GAGCCAGAGAAAATAACTCAAGG + Intronic
1056963183 9:91144529-91144551 GGGCTAAAGAAAATAACCAAAGG - Intergenic
1057209731 9:93193200-93193222 GGTGCATACAAAATACCCCAGGG + Intronic
1059788547 9:117614079-117614101 TGGTCATGAAGAATAACCCAAGG + Intergenic
1186134924 X:6509056-6509078 GGGTCAGAAAAAATAACTCAGGG + Intergenic
1188097444 X:26042282-26042304 GGGACATAACTGATAACCCAGGG - Intergenic
1191999254 X:67130596-67130618 GGGCCACACAAAATAAAGCAGGG - Intergenic
1193420763 X:81279928-81279950 GGGGCTTAAAAATTCACCCAAGG - Intronic
1193629762 X:83869332-83869354 GGATCATAAAAAATAACTAATGG - Intronic
1197326845 X:125105026-125105048 GGACCATAGAAAATGACCCCAGG - Intergenic
1198840397 X:140850760-140850782 GGGGCAAAAAAAATAAGCTATGG + Intergenic
1199374353 X:147089209-147089231 GGGCCAGAGAAAATTACACAAGG + Intergenic
1199532980 X:148870744-148870766 GGGCTATTAAAAATAACAAAAGG + Intronic
1199752307 X:150831622-150831644 GGGTCAGGAAAAATAACCAATGG + Intronic
1200272898 X:154703528-154703550 GGATCAGAAAAAATAACCAATGG + Intronic
1200360386 X:155599154-155599176 GGGGAATAAAAAATTACACATGG + Intronic
1201487503 Y:14508488-14508510 GGGACATAACAAATTATCCAGGG - Intergenic
1201945308 Y:19504229-19504251 GGGTGCTAAAAAATAACCAAGGG + Intergenic