ID: 1009297423

View in Genome Browser
Species Human (GRCh38)
Location 6:61970531-61970553
Sequence CTCAGTAATCTCTAAATGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009297423 Original CRISPR CTCAGTAATCTCTAAATGCT AGG (reversed) Intronic
904582439 1:31555492-31555514 CTGAAAAATCACTAAATGCTTGG - Intergenic
908063178 1:60373612-60373634 CACAGGCATCTCTAAATACTTGG - Intergenic
908617496 1:65938398-65938420 CTCAGAAATTTATGAATGCTAGG - Intronic
909508866 1:76427727-76427749 CTCAGTTATCTCTGAATTCCTGG - Intronic
909682284 1:78305628-78305650 ATCAGTAAACTCCAAATGGTGGG - Intronic
912562153 1:110558718-110558740 CTCAGCAATCTGTAAGTTCTTGG + Intergenic
913136325 1:115893087-115893109 CTCAGAGATCTCTAACTACTGGG + Intergenic
916458834 1:164999646-164999668 TTAATTAATCTCTAAATACTAGG - Intergenic
920014320 1:202894040-202894062 CTCTGTTTTCTCTAAATACTAGG - Intronic
920113898 1:203606335-203606357 CTGAGTAATTTCTACAAGCTAGG - Intergenic
921108822 1:212012502-212012524 CTCAGCAATCCCAAATTGCTGGG - Intronic
921279487 1:213551395-213551417 CTGGGTAATGTCTAAGTGCTCGG + Intergenic
921300048 1:213743540-213743562 CTCAGCAATCTCAAAACCCTTGG - Intergenic
921587909 1:216969834-216969856 CTCAGCACTCTCAAAGTGCTGGG + Intronic
921741074 1:218685821-218685843 CTGATTAATCTCCAAATACTGGG + Intergenic
1063768757 10:9173573-9173595 CTTAATAATCTCTAAATGTATGG + Intergenic
1064707354 10:18086623-18086645 CTCTGTAACCTCTAACTCCTGGG - Intergenic
1068842223 10:61628366-61628388 CTCAGAAATTTCAAAATTCTTGG + Intergenic
1069702205 10:70435122-70435144 CTCGGTCATCTCTACATGCCTGG + Intronic
1070248434 10:74752986-74753008 TTAAGTAATCTCTATGTGCTAGG - Intergenic
1074654423 10:115568570-115568592 CTCAGCAAGTTCTTAATGCTTGG + Intronic
1075865236 10:125713007-125713029 CTCAGAAATCACTGCATGCTGGG + Intergenic
1076409403 10:130235035-130235057 CTCAGAAAGTTCTAACTGCTGGG - Intergenic
1077572063 11:3347396-3347418 CTCAGTTAGCTGTAAATGCATGG - Intronic
1077596161 11:3533581-3533603 CACTGTAATCTCAAAATCCTGGG + Intergenic
1078847945 11:15138498-15138520 CACAGCAATCTCTATGTGCTAGG + Intronic
1084113640 11:67029206-67029228 CTCAGTCATTCCTAAAAGCTGGG + Intronic
1084290560 11:68163211-68163233 CTCAGCAATTACTACATGCTAGG + Intronic
1085327880 11:75621610-75621632 CTGAGTATTTTCTAAATGCAAGG - Intronic
1085766777 11:79290122-79290144 CTCTCTAATCTATAAATGATGGG + Intronic
1085945239 11:81262080-81262102 CACAGTTATCTCTCAATTCTGGG - Intergenic
1087398671 11:97635612-97635634 CTTAGTACTCTTTAAATTCTAGG - Intergenic
1087562505 11:99808531-99808553 CTCAGTAACCTGTAATTCCTAGG + Intronic
1089541961 11:119194629-119194651 CACTGTAATCTCTAACTCCTGGG - Intronic
1093178609 12:15942639-15942661 CTCAGTAATCAGTGAATGCCTGG + Intronic
1093930455 12:24950334-24950356 CTGAGTGATTTCTACATGCTAGG + Intergenic
1096265933 12:50122641-50122663 CACAGTAACCTCTAACTCCTAGG - Intergenic
1097710410 12:62911578-62911600 CTCAGAAATAAGTAAATGCTGGG - Intronic
1100910147 12:99350812-99350834 CTCAGTATTTTCAAAATGATTGG + Intronic
1102105852 12:110322432-110322454 CTCACTGATCTCTACATCCTGGG + Intronic
1104226123 12:126835710-126835732 CATAGTAATCTCTAACTGTTGGG + Intergenic
1105276819 13:18937497-18937519 CACTGTAACCTCTAACTGCTGGG + Intergenic
1107257247 13:38442655-38442677 CACTGTCATCTCCAAATGCTGGG - Intergenic
1107507812 13:41052638-41052660 CACTGCAACCTCTAAATGCTGGG - Intronic
1107786339 13:43961856-43961878 TTCGGTAATCCCAAAATGCTGGG + Intergenic
1109623891 13:64948620-64948642 CTCACTAAATTCAAAATGCTAGG + Intergenic
1109897730 13:68715758-68715780 CTGACTAATCTTTAAATGTTAGG - Intergenic
1110681600 13:78319996-78320018 GTTAGTAGTCTCTGAATGCTGGG - Intergenic
1111002734 13:82206063-82206085 CTCAGGACCCACTAAATGCTGGG + Intergenic
1112467331 13:99655461-99655483 CTCAGCAACCTCTAGTTGCTGGG + Intronic
1114344891 14:21784091-21784113 CTCGGGAACCTCTAAATCCTAGG - Intergenic
1114515384 14:23296423-23296445 CTCAGTAACCTCCAACTCCTGGG + Exonic
1115503359 14:34068834-34068856 TTCATTAATCTTTCAATGCTAGG - Intronic
1115736164 14:36332447-36332469 CTCTGTCATATCTAAATCCTTGG - Intergenic
1118091151 14:62480879-62480901 CTCAGTGATGGCTAAAAGCTAGG - Intergenic
1118857186 14:69632744-69632766 CTCAGTGAACACCAAATGCTAGG - Intronic
1119652905 14:76396324-76396346 CTTTTTAAGCTCTAAATGCTGGG + Intronic
1125987158 15:44064786-44064808 TTCAGTGATCTTTAAATTCTGGG - Intronic
1126478650 15:49093508-49093530 CTCAGTTATCTATGAATACTTGG + Intergenic
1128344665 15:66845820-66845842 CTCAGAAATCTTTGAATTCTAGG + Intergenic
1128942548 15:71800442-71800464 CTCACTGATCTCCAAATCCTGGG + Intronic
1129144912 15:73638050-73638072 TTCAATAATTTTTAAATGCTGGG + Intergenic
1131078867 15:89517247-89517269 CTTAGTATTCTCTAAGTTCTGGG - Intergenic
1131330510 15:91494779-91494801 CTCAGTAATTTATTAATTCTAGG + Intergenic
1132221494 15:100108791-100108813 CTCAGTAATGACTGAGTGCTAGG - Intronic
1133643613 16:7741797-7741819 ATCAGTAATGTCTCTATGCTAGG - Intergenic
1133890765 16:9876679-9876701 GTCAGTAATCAGTGAATGCTTGG + Intronic
1137826188 16:51497877-51497899 TTCAGTAACCTCTTAATGGTTGG + Intergenic
1138314957 16:56061950-56061972 CACTGTAATCTCTAATTCCTGGG - Intergenic
1138953123 16:61938367-61938389 CTCATTAATATCTAAATGCAAGG - Intronic
1138990837 16:62388967-62388989 CACTGTAATCTCTAATTCCTGGG - Intergenic
1140156604 16:72435223-72435245 TTCAGTAATCTCATAGTGCTGGG - Intergenic
1140212944 16:72985101-72985123 CTACGTAATCTCGAAATGATGGG + Intronic
1140420113 16:74812459-74812481 CTCAGTGTTCTCCAAATGGTGGG + Intergenic
1140792116 16:78401947-78401969 CTCTGTAATCCCAAAGTGCTGGG + Intronic
1140831178 16:78752997-78753019 TTCAGTAATCTCTTAGGGCTGGG + Intronic
1141409017 16:83819612-83819634 CTCAGGAAGCTTTAAATGATTGG - Exonic
1145928247 17:28664204-28664226 CTATCTAATGTCTAAATGCTGGG + Intronic
1150831326 17:68522281-68522303 CTCAGTAATCTAGACATTCTTGG + Intronic
1151292669 17:73161836-73161858 CTGAATAATCCCAAAATGCTGGG - Intergenic
1153585236 18:6614106-6614128 CACAGTAATCTAGAAATGCTAGG - Intergenic
1158550046 18:58428211-58428233 CACTGTAATCTCTAACTCCTGGG - Intergenic
1163161324 19:15466028-15466050 CTCTGTAACCTCTAACTCCTGGG + Intergenic
1163844374 19:19630062-19630084 CTGGGTAATCTCAAAATGCTTGG + Exonic
1165041887 19:33074369-33074391 CTCAGCAATCCCAAAGTGCTGGG - Intergenic
1165230327 19:34382725-34382747 CTAACTCATCTCTACATGCTGGG - Intronic
1168217003 19:54933798-54933820 CTCAGTGATGTCCACATGCTAGG + Intronic
925254735 2:2473573-2473595 CTTAGTAATCTCTGCATTCTAGG + Intergenic
926832209 2:16976063-16976085 CTTTGTAATCTCAAAATGCTGGG + Intergenic
927580979 2:24247042-24247064 GAAAGTAATCTCTAAATCCTTGG + Intronic
927873188 2:26637235-26637257 CTCAGGAACCTCCAAATGCCAGG - Intronic
928010066 2:27599100-27599122 GTCTGTAATCTCAAAGTGCTGGG + Intronic
929890480 2:45914624-45914646 CTGAGGAAGCTCTAAATGCATGG - Intronic
940462631 2:153986388-153986410 CACAGTAATCAATAAGTGCTAGG + Intronic
940855435 2:158725377-158725399 CTCAGTTATCTCTAAAGGGCGGG + Intergenic
941943758 2:171072316-171072338 TTGAGTAATGTCTAAAAGCTGGG + Intronic
942372424 2:175299651-175299673 CTCAGTATTCTCTAATGCCTAGG + Intergenic
945199400 2:207266108-207266130 CTCAGTGCTCTCTCAAAGCTGGG + Intergenic
946579202 2:221108032-221108054 CTCAGTAACCACTAAAAGATAGG + Intergenic
946637863 2:221750058-221750080 ATCATTAACCTCTAAATGGTCGG - Intergenic
1171992468 20:31707400-31707422 CTAAGTAATTACTATATGCTGGG + Intronic
1174033622 20:47651581-47651603 CTCTCTAATCTCTGAATGCTTGG + Intronic
1175287521 20:57847028-57847050 CTGATTAATCTCTTACTGCTTGG + Intergenic
1178190611 21:30275483-30275505 CTCAGTAATCTCTAATAAGTAGG - Intergenic
1178596737 21:33961164-33961186 CTAAGTAATGGCAAAATGCTTGG + Intergenic
1182724663 22:32434626-32434648 CTCAGTAATCCCTAAAAGTGAGG - Intronic
949477369 3:4461257-4461279 CTCACTATACTCTAAGTGCTGGG + Intronic
951996782 3:28738794-28738816 TTTATTAATGTCTAAATGCTAGG - Intergenic
952930422 3:38355998-38356020 CTCTGTAATCCCAAAGTGCTGGG - Intronic
953395941 3:42569956-42569978 CTCACTAATCCCTAATTGCAGGG - Intronic
954051535 3:47983282-47983304 CACTGTAACCTCAAAATGCTGGG + Intronic
955252782 3:57301188-57301210 CACTGTAATCTCAAAATCCTGGG - Intronic
955733465 3:62011703-62011725 CTGAGTATTCTCTAAGTACTAGG - Intronic
958482353 3:94659028-94659050 CTCAGTAATACCTAAATAATTGG + Intergenic
963413776 3:144967611-144967633 TTTACTAATTTCTAAATGCTTGG + Intergenic
965135777 3:164765444-164765466 CTAATTATTCTCTAAATGTTTGG + Intergenic
967415743 3:189216288-189216310 ATCATTAATCTTTAACTGCTGGG + Intronic
967637959 3:191826633-191826655 CTGAGAAATCTCTAAATATTTGG + Intergenic
967729106 3:192890835-192890857 CTCAGGAGTCCCTAAATACTAGG + Intronic
967762672 3:193242549-193242571 CTTATTAATCTCTACATTCTAGG - Intronic
968033903 3:195528805-195528827 CTCTGTAATCTCAAAGTGCTGGG + Intronic
969715021 4:8864179-8864201 GTCTGTAATTTGTAAATGCTGGG - Intronic
970920726 4:21391404-21391426 CTCAGTAATTTTTTGATGCTAGG + Intronic
971065066 4:23022152-23022174 CTCAAGAATCTCAAAAGGCTGGG - Intergenic
971720269 4:30235997-30236019 TTAAGTAGTATCTAAATGCTTGG + Intergenic
972870804 4:43295029-43295051 CTCTGTATTCTCTACAGGCTAGG - Intergenic
974239081 4:59221247-59221269 AACAATAATCTCTAAAGGCTAGG - Intergenic
976933679 4:90601840-90601862 CTGAATAATCTCCAACTGCTGGG - Intronic
979853294 4:125600333-125600355 ATTAGAAATCTCTAAATCCTAGG + Intergenic
986033487 5:3915514-3915536 CTCAATAATCCCTAGATTCTTGG - Intergenic
986218895 5:5748868-5748890 CTAAATAATCTCTGCATGCTTGG - Intergenic
987051392 5:14149286-14149308 CTCAGTAACATCAAAAAGCTGGG - Intronic
988069704 5:26272182-26272204 CTGAAAAATCTCTAAATACTTGG - Intergenic
989550647 5:42731818-42731840 CTCATTCAAATCTAAATGCTTGG + Intergenic
990058287 5:51613515-51613537 CTAACTAATCTACAAATGCTGGG - Intergenic
991197091 5:63947740-63947762 CTCAGTAATGTAAAAATCCTAGG - Intergenic
991734804 5:69621904-69621926 CTCTGCAATCTATAAATGATGGG + Intergenic
991768303 5:70014173-70014195 CTCAGTAAAACCTAAATCCTTGG + Intergenic
991780174 5:70124814-70124836 CTCTGCAATCTATAAATGATGGG - Intergenic
991811238 5:70477039-70477061 CTCTGCAATCTATAAATGATGGG + Intergenic
991847541 5:70889255-70889277 CTCAGTAAAACCTAAATCCTTGG + Intergenic
991859461 5:71000243-71000265 CTCTGCAATCTATAAATGATGGG - Intronic
991872621 5:71125137-71125159 CTCTGCAATCTATAAATGATGGG - Intergenic
992867937 5:80976529-80976551 CTCTATAATCTCTATGTGCTGGG + Intronic
993048463 5:82896340-82896362 TTCACTAATCTTTAAAAGCTAGG + Intergenic
993416900 5:87645436-87645458 CTTAGTCATCTCTAAGTGCCTGG - Intergenic
995865635 5:116687000-116687022 CTCAGTGCTCTGCAAATGCTAGG - Intergenic
996496056 5:124158054-124158076 ATAAGTAATTTCTAAAGGCTTGG - Intergenic
999168091 5:149568574-149568596 CTCAGGCCTCTCAAAATGCTGGG - Intronic
999382885 5:151134108-151134130 ATTAGTGATTTCTAAATGCTTGG + Intronic
999461335 5:151759615-151759637 ATAAGTATTCTCTAATTGCTAGG + Intronic
1000854175 5:166378986-166379008 CTCAGGACTCACTAAATGGTGGG - Intergenic
1000868382 5:166543611-166543633 CACTGTAATCTCAAACTGCTGGG - Intergenic
1002814925 6:670685-670707 CTCTTTAATCTCTGAATGATTGG + Intronic
1003286871 6:4742108-4742130 CTGAGTAATCCCAAAATGTTGGG - Intronic
1003833507 6:10041337-10041359 TTCAGGAATCTCTGAATACTGGG - Intronic
1007063159 6:38962602-38962624 CACATTAAACTCTAAATGTTAGG + Intronic
1008392718 6:50971541-50971563 TTCATTCAACTCTAAATGCTAGG + Intergenic
1009297423 6:61970531-61970553 CTCAGTAATCTCTAAATGCTAGG - Intronic
1010438875 6:75869782-75869804 TTCAGTTATTTTTAAATGCTTGG - Intronic
1011573266 6:88763192-88763214 CTCAGACATCTCAAAGTGCTGGG + Intronic
1012322198 6:97863379-97863401 CTTAGTAATCTCCAAAAACTGGG + Intergenic
1012594751 6:101026233-101026255 CTCTGTAACATCTAAAAGCTAGG - Intergenic
1013595175 6:111654085-111654107 CTGAGCAATCTCTAGAGGCTTGG + Intergenic
1014744389 6:125182847-125182869 CACAGTAATTTTTAAATACTTGG - Intronic
1014905887 6:127026292-127026314 GTCATTAATCTGGAAATGCTTGG + Intergenic
1015500055 6:133922513-133922535 CTCAGCACTCCATAAATGCTAGG - Intergenic
1017199917 6:151741522-151741544 CCCAATCATCTCTAACTGCTGGG - Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1022211451 7:28214165-28214187 CTCAGTGATCCCTGAAGGCTTGG - Intergenic
1023087847 7:36590026-36590048 CTCAGCAATCTCAAACTCCTGGG + Intronic
1023911697 7:44560993-44561015 CTCATGAAGCTCTAATTGCTGGG - Intergenic
1026010229 7:66630059-66630081 CTGACTAGTCTCTAACTGCTGGG - Intronic
1026979299 7:74517273-74517295 CTCGGTAATCCCAAAGTGCTGGG + Intronic
1028598705 7:92576406-92576428 CTGAGTACTTTCTAGATGCTAGG + Intronic
1030258682 7:107540500-107540522 CACTGTAACCTCTAAGTGCTGGG - Intronic
1032636019 7:133710118-133710140 CCAAGTATTCTCTAAATGCCTGG - Intronic
1033335963 7:140452502-140452524 CTCTGTAATCCCAAAGTGCTGGG + Intergenic
1037159959 8:15757608-15757630 CTTAATCATCTCTAAATCCTTGG - Intronic
1039727957 8:40241378-40241400 CTCAATCATCTTTAAATTCTTGG - Intergenic
1039988854 8:42470651-42470673 GTCAATAATCTCTAAATTCCAGG + Intronic
1042571711 8:70172209-70172231 CTCTGTAATCCCAAAGTGCTGGG + Intronic
1045065137 8:98437563-98437585 CTCAGAAATCTTTAAATGTCTGG - Intronic
1045455648 8:102376324-102376346 ATCAGAAATCTCTAAATACAAGG + Intronic
1049926104 9:408969-408991 CACAGTAATCCCTGATTGCTGGG + Intronic
1049967967 9:796430-796452 CTTTGTATTTTCTAAATGCTTGG - Intergenic
1050313170 9:4373612-4373634 CTCATTAATTTCTAAGTGTTAGG - Intergenic
1051736676 9:20207068-20207090 CTCAGTATTTACTAAATACTAGG - Intergenic
1051839239 9:21375776-21375798 CTCTGTAGTCACTAAATGGTTGG + Intergenic
1056992846 9:91426558-91426580 CTCAGCAACCTCTCAGTGCTAGG + Intergenic
1057528009 9:95819496-95819518 CACAGAAATCTCCAAATGCTGGG - Intergenic
1058954351 9:109931661-109931683 ATCAGAAATCTCTAGATTCTAGG - Intronic
1059423194 9:114205529-114205551 CTCAGTAATTTCTTATTCCTGGG + Intronic
1060769604 9:126322515-126322537 TTCAGCATTCTCCAAATGCTGGG + Intergenic
1186640139 X:11446933-11446955 ATGAGGAGTCTCTAAATGCTAGG + Intronic
1188137692 X:26509966-26509988 CTCTGTAACCTCAAACTGCTGGG + Intergenic
1198637707 X:138717689-138717711 CTCTGTAACCTCTAACTCCTGGG + Intronic
1200963014 Y:9012198-9012220 GGCAGAAATCTCTAACTGCTGGG + Intergenic
1201351834 Y:13052486-13052508 TTCAGTAATCCCTAAAAGTTCGG - Intergenic