ID: 1009306185

View in Genome Browser
Species Human (GRCh38)
Location 6:62092193-62092215
Sequence ATTCACTGTCTGACATGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009306185_1009306195 23 Left 1009306185 6:62092193-62092215 CCCCTTCATGTCAGACAGTGAAT 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1009306195 6:62092239-62092261 CACTGCATAACTCACCCAAATGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009306185 Original CRISPR ATTCACTGTCTGACATGAAG GGG (reversed) Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
901389764 1:8937087-8937109 AATCACAGTTTGGCATGAAGAGG - Intergenic
902522525 1:17028469-17028491 ATTTACTATCTGACTAGAAGAGG + Intronic
909970092 1:81973352-81973374 GTTCAATGGCTGACATGAAGAGG + Intronic
910536676 1:88305958-88305980 AGTCAATGACTGAGATGAAGAGG - Intergenic
912723319 1:112038144-112038166 GGTCAGTGTCTGACATCAAGGGG - Intergenic
918424880 1:184398289-184398311 ATTCTCTGTCTGTGAAGAAGAGG - Intronic
919735130 1:200944323-200944345 ATTCACTGGATGAGATCAAGAGG - Intergenic
920627374 1:207615442-207615464 AATCAGTGTCTGAAATGATGAGG + Intronic
920637312 1:207716331-207716353 AATCAGTGTCTGAAATGATGAGG + Intronic
921752853 1:218817734-218817756 AGCCACAGTCTGACTTGAAGGGG - Intergenic
1063599538 10:7467673-7467695 ATTCACTTTCTTACACGAACAGG + Intergenic
1067508820 10:46878244-46878266 ATTCACTGGCAGCCATGATGGGG + Intergenic
1067653429 10:48173606-48173628 ATTCACTGGCAGCCATGATGGGG - Intronic
1069313088 10:67063543-67063565 TATCACTGTCAGATATGAAGTGG + Intronic
1069785255 10:70983787-70983809 ATTCATTGTCAGACACTAAGCGG + Intergenic
1070570069 10:77634385-77634407 ATTCACTGTTTGAGATTCAGAGG + Intronic
1073755219 10:106574203-106574225 ATTCACTGTCCAAAATGCAGAGG - Exonic
1074554509 10:114476060-114476082 AATCACTGCCTGACCTGAATTGG - Intronic
1077924035 11:6662879-6662901 AGTGAATGGCTGACATGAAGGGG + Intergenic
1079698249 11:23510922-23510944 GTTTACACTCTGACATGAAGTGG + Intergenic
1080710714 11:34745313-34745335 ATTCACTGTCTGAGAAGCTGAGG + Intergenic
1082703624 11:56465077-56465099 TTTCACTCTCTGTCTTGAAGAGG - Intergenic
1083803393 11:65059357-65059379 GTGCAGTGTCTGACATGTAGTGG + Intergenic
1085732642 11:79012521-79012543 TCTCACTGTCTGACACAAAGTGG + Intronic
1087383378 11:97437972-97437994 ATACCCTGGCTGACATGAAATGG + Intergenic
1087943721 11:104132737-104132759 ATTCACTGTGGGACAGGAAATGG + Intronic
1090141106 11:124263885-124263907 ATTCACTGTTTAACAGAAAGGGG + Intergenic
1090790319 11:130087535-130087557 ATTCCCTGTCTGTGATGTAGAGG + Intronic
1092973843 12:13724982-13725004 ATTTACTGTTTCAGATGAAGGGG - Intronic
1095414510 12:41961831-41961853 TTTCTTTTTCTGACATGAAGGGG - Intergenic
1098657699 12:73053629-73053651 ATTCTCTGACTTACATTAAGAGG + Intergenic
1104432974 12:128731959-128731981 CTTCACTGTCAAACATGTAGGGG - Intergenic
1111095218 13:83504748-83504770 ATACACTCTCTGACATGCAAGGG + Intergenic
1111693823 13:91597684-91597706 ATGCAGTTTCTGCCATGAAGGGG - Intronic
1112850986 13:103706473-103706495 ATTAACTGTCTGAAAAGAAATGG - Intergenic
1115464113 14:33695386-33695408 ATACACTGTCTAATATTAAGAGG + Intronic
1115758793 14:36557170-36557192 ATTTGCTGTATGTCATGAAGTGG + Intergenic
1115780227 14:36760540-36760562 ATTCACTGCCTGTCATGGGGAGG + Intronic
1116122882 14:40743015-40743037 ATTCACAGTATGACATAAATAGG + Intergenic
1124720147 15:32104627-32104649 GTTCACTGTCTCACCTGTAGCGG + Intronic
1125227024 15:37407270-37407292 AACCACTGGGTGACATGAAGAGG - Intergenic
1125612122 15:40978647-40978669 ACCAACTGTCTGACATGCAGTGG - Intergenic
1128075886 15:64825269-64825291 ATTCACTGGCTTATATGCAGCGG + Intronic
1128107353 15:65054739-65054761 ATTCACTGTGTGAGCTGGAGTGG - Exonic
1130313897 15:82778957-82778979 AGTCACTGTCATAAATGAAGAGG + Intronic
1131741866 15:95401457-95401479 ATTTACTGTCTGACAAGAAAAGG + Intergenic
1134778789 16:16876530-16876552 ATTCTCATTCTGACTTGAAGAGG + Intergenic
1137298384 16:47120911-47120933 ATTGCCTATCTGACATGAAAAGG - Intronic
1139008929 16:62608463-62608485 ATTAACTGTATAACATTAAGTGG - Intergenic
1144042003 17:11420319-11420341 ATTCAATGTTTTACATGAATAGG - Intronic
1145828429 17:27895180-27895202 ATGCACTGTCTGACATAAGGGGG - Intergenic
1154023458 18:10685229-10685251 ATCCCCTGTCTGGAATGAAGTGG - Intronic
1157806237 18:50659810-50659832 ATTCACTGTCTGAGATGGAAAGG - Intronic
1158670761 18:59471713-59471735 TGTCACTGTCAGAAATGAAGAGG - Intronic
1160355447 18:78224467-78224489 ATTCCTTGCCTGCCATGAAGAGG + Intergenic
1161509286 19:4661763-4661785 AGTCACTGTCTGAGATGAGGAGG + Intronic
1163197472 19:15733136-15733158 ATGCATTGTCTGACATTTAGTGG - Intergenic
1163388999 19:17018356-17018378 ATTCAATGTCTGAGAGGCAGTGG + Intronic
1164901497 19:31929939-31929961 ATTCAATGTCTTTCAAGAAGAGG - Intergenic
1166909378 19:46140923-46140945 CTTCATGGTCTGGCATGAAGTGG + Intergenic
1166923943 19:46252646-46252668 CTTCATGGTCTGGCATGAAGTGG - Intergenic
925718983 2:6810208-6810230 GTTCACTGTCAGACAGGGAGAGG - Intergenic
926868530 2:17386707-17386729 ATTCACTGCCTAACATCAAAGGG + Intergenic
929942585 2:46346352-46346374 AATCACTTTCTGGTATGAAGCGG + Intronic
930765889 2:55084712-55084734 AGTCAATGTCTGCCAAGAAGTGG + Intronic
930852786 2:55978701-55978723 TTTCATTGCCTGACATGCAGGGG + Intergenic
931254478 2:60557811-60557833 ATTCACTGTCTGCCTTTAGGGGG + Intergenic
938980063 2:136517917-136517939 CTGCACTGTTTGACAGGAAGTGG + Intergenic
939664873 2:144938623-144938645 TTTCACTTTCTGACAGGAAATGG + Intergenic
941185099 2:162312559-162312581 ATTCATTTTCTGGCAAGAAGTGG + Intronic
942200516 2:173566382-173566404 AATCTCTGTTTGTCATGAAGTGG + Intergenic
943268637 2:185770529-185770551 ACTCACTGTTTACCATGAAGTGG + Intronic
943753866 2:191538005-191538027 TTTCAGTGACTTACATGAAGAGG - Intergenic
944336765 2:198543327-198543349 AGTCCCTGTCTGCCATTAAGGGG - Intronic
945962231 2:216147407-216147429 TTCCACTGTCTGACTGGAAGTGG - Intronic
946320044 2:218947807-218947829 GTTCACTGCCTGGCATGTAGAGG + Intergenic
946522211 2:220478787-220478809 ATGCCTTGTGTGACATGAAGAGG + Intergenic
1172297130 20:33820629-33820651 ATTCAGTTTGTGACATGCAGTGG + Intronic
1173537750 20:43828948-43828970 CCTCACTGTCTGACCTGACGTGG - Intergenic
1176511129 21:7748962-7748984 ATTCACAGTCTACCATGAATTGG + Exonic
1177361072 21:20072051-20072073 ATCCACTGTCTCACATACAGCGG - Intergenic
1177882503 21:26710836-26710858 ATTCATTATCTGACATGACTTGG + Intergenic
1178645243 21:34379491-34379513 ATTCACAGTCTACCATGAATTGG + Exonic
1179213298 21:39345343-39345365 ATTACTTGTCTGACATGAAGGGG - Intronic
1182342097 22:29631453-29631475 CTTCCCTGTCAGACATGAACAGG + Intronic
1183629671 22:39025543-39025565 ATGCAAAGTCTGAGATGAAGAGG - Exonic
1185170833 22:49293004-49293026 ATGCACTGTCTTGCATGCAGGGG - Intergenic
951081604 3:18456395-18456417 ATTCACTGTGTGAACTGAGGAGG - Intergenic
952076756 3:29706154-29706176 ATTCTCTTCCTGACATCAAGTGG - Intronic
952942894 3:38456729-38456751 ATTCACAGTCTTACAAAAAGAGG - Intronic
956827267 3:73009495-73009517 ATTCACTGGCAGACACTAAGTGG - Intronic
960423730 3:117480773-117480795 ATTCACTGTCTCAGCTTAAGGGG + Intergenic
960621644 3:119642679-119642701 ACTCACTGCCTGACATGATAGGG + Intronic
962963473 3:140332657-140332679 ATACACTGTGTGACAGGAAGGGG - Intronic
963634764 3:147780416-147780438 ATTCACTGTCTGAGATTATGTGG - Intergenic
964221880 3:154356167-154356189 ATTCACTTGCTCACTTGAAGTGG + Intronic
966969428 3:185029525-185029547 ATGCACACTCTGACATGCAGCGG - Intronic
967044200 3:185721566-185721588 ATTCACTTGCTGAGATGAGGAGG - Intronic
971349088 4:25840754-25840776 AGTTACTGTCTGCCATGGAGTGG - Intronic
977724680 4:100282214-100282236 ATTCACTTTCCCACATTAAGGGG + Intergenic
978066143 4:104405228-104405250 TTTTCCTGTCTCACATGAAGAGG - Intergenic
978253421 4:106661563-106661585 ATTCATTCTCTCACATGAAAGGG - Intergenic
978768544 4:112430217-112430239 AGTGACTGGCTGGCATGAAGGGG - Intronic
978865489 4:113504456-113504478 CTTCACTTTCTGAGATAAAGAGG - Intronic
981564869 4:146089417-146089439 ATTCAATATATGACATGAAGGGG + Intergenic
983538422 4:168882619-168882641 TTTCATTCTCTGACCTGAAGGGG + Intronic
987012194 5:13778881-13778903 ATTCCCAGTATGACATGCAGAGG + Intronic
989306099 5:39958281-39958303 ATTCTATGTCTGAGATCAAGGGG - Intergenic
991220273 5:64206372-64206394 ATGCAGTGGCTGACATGAATAGG + Intronic
991345831 5:65667254-65667276 ATTCAGTGTCAGAAATGAAAGGG - Exonic
991628781 5:68632799-68632821 AGTCACTGTTAGGCATGAAGAGG - Intergenic
993605158 5:89980875-89980897 AATCACTTTCTGCCATCAAGTGG + Intergenic
994647130 5:102484248-102484270 ATTAGCTGTCTGACATGATTGGG - Intronic
996235179 5:121119293-121119315 AATTACTGCCTGAAATGAAGAGG + Intergenic
997711290 5:136006977-136006999 CTCTACTGTCTGACATGTAGAGG + Intergenic
1008417608 6:51261276-51261298 ATCCACTGTATCTCATGAAGGGG + Intergenic
1009306185 6:62092193-62092215 ATTCACTGTCTGACATGAAGGGG - Intronic
1009774123 6:68182791-68182813 ATTCACAGCCAGAAATGAAGTGG - Intergenic
1011149620 6:84255996-84256018 ATTCTGTGTCTGATATAAAGTGG - Intergenic
1011625113 6:89277024-89277046 ATTCACTATTTGACATGATTAGG + Intronic
1014553902 6:122822268-122822290 ATTCACAGAATGAGATGAAGAGG - Intergenic
1018465037 6:164036208-164036230 ATTTTCTGTTTGACATGAAAGGG - Intergenic
1018572036 6:165222090-165222112 ATAAACTGTCTGCCATAAAGAGG + Intergenic
1023560286 7:41466957-41466979 GTTCAGTGACTGACATTAAGTGG - Intergenic
1024874437 7:54005865-54005887 ATTCACTATCTGTAATGTAGAGG - Intergenic
1028516563 7:91683871-91683893 TTTCACTATCTGTCATGCAGGGG - Intergenic
1032327262 7:130941566-130941588 CTTCAGTGTCTGACATGAACTGG - Intergenic
1032413678 7:131719687-131719709 ATTGACTGTCTGACAATAGGAGG + Intergenic
1032704429 7:134409707-134409729 ATCCACTGGCTGAGATGCAGTGG - Intergenic
1033035431 7:137871732-137871754 ATTCACTGTGTGACCTAATGTGG + Intergenic
1033405632 7:141070205-141070227 TTTCACTGTCTGAAGTGGAGTGG + Intergenic
1035613644 8:986636-986658 ATACAGTGTTTGACATGCAGTGG - Intergenic
1036071542 8:5445763-5445785 ACACACTGGCTGACATAAAGGGG + Intergenic
1036596172 8:10214362-10214384 GTTTCCTGTCTGACATGAATGGG + Intronic
1038480355 8:27897570-27897592 ATTCTCTGGCAGACATGCAGTGG - Intronic
1041407769 8:57519105-57519127 ATTCACTGTCACACATGGAGAGG + Intergenic
1042357414 8:67843897-67843919 AATCACTGTCAAACATGAAATGG + Intergenic
1044903900 8:96978923-96978945 ATTATTTGCCTGACATGAAGTGG - Intronic
1045609656 8:103823142-103823164 ATTCACTGTCACACATTCAGTGG - Intronic
1045616194 8:103914726-103914748 ACTCACTGACTGAAATGAATTGG - Intronic
1045955804 8:107905101-107905123 AATCACTGTCTGACTGGCAGTGG - Intronic
1046691065 8:117284824-117284846 AATCACTGTCTTTCAAGAAGAGG - Intergenic
1047664443 8:127075272-127075294 ATTAAGTGGCTGGCATGAAGAGG - Intergenic
1051861188 9:21626917-21626939 AATTACTGTCTGACAAGAAAAGG - Intergenic
1055740306 9:79381113-79381135 AGTCAATGGCTGACATGGAGAGG - Intergenic
1056553424 9:87670260-87670282 ATTCACTGTCTTTCAAGCAGAGG + Intronic
1057902689 9:98961783-98961805 ATTCACTGTCTGATAAGCAGAGG - Intronic
1059961472 9:119569291-119569313 ATTCACTTTCTGAAATGATCTGG - Intergenic
1061106929 9:128538143-128538165 ATCCACTGGGTGACATGAATGGG + Intronic
1062410403 9:136421247-136421269 ATTGTCTGTGTGACATGCAGCGG - Intronic
1187221214 X:17327888-17327910 ATTCACTGTCTGTCTTTATGTGG - Intergenic
1187494286 X:19781036-19781058 AAACAATGTCTGCCATGAAGTGG + Intronic
1187965652 X:24608760-24608782 TTTCTCTCTCTGACTTGAAGGGG - Intronic
1188781958 X:34296159-34296181 TTTCACTGCCTGAAATAAAGTGG + Intergenic
1198052331 X:132961049-132961071 ATTCACTGCCTGAGAGGAACTGG - Intronic