ID: 1009318504

View in Genome Browser
Species Human (GRCh38)
Location 6:62255486-62255508
Sequence CCTGCTCTGCAGCTAGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009318504_1009318507 2 Left 1009318504 6:62255486-62255508 CCATGCACTAGCTGCAGAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 189
Right 1009318507 6:62255511-62255533 GTCGAACTCTCACAGTTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009318504 Original CRISPR CCTGCTCTGCAGCTAGTGCA TGG (reversed) Intronic
900900791 1:5514247-5514269 CCTGCTCTGCAGAGAATGGATGG - Intergenic
900986483 1:6076134-6076156 GCAGCCCTGCAGATAGTGCAGGG - Intronic
901037268 1:6343853-6343875 CCTGCTCTGCAGCTGGTTTCTGG + Intronic
901166698 1:7226369-7226391 CCTGCTCTGCACCCAGTCCTAGG - Intronic
901322803 1:8349724-8349746 CTTGCTCTGCAGATATTGGAGGG - Intergenic
902407277 1:16191668-16191690 CCTGCTCTGCAGAGACTGTAGGG - Intergenic
902510871 1:16966310-16966332 CCTGCACTCCACCCAGTGCAGGG - Intronic
904266406 1:29320716-29320738 GGTGCTCTGCAGCGGGTGCAGGG - Exonic
904319773 1:29689352-29689374 CCTACTGTGAAGCTAGGGCAGGG + Intergenic
905852057 1:41281841-41281863 CCTGCATTGCAGCTAGTTCAGGG + Intergenic
905947544 1:41916763-41916785 CCTGCTGAGCAGCCAGTGTAGGG - Intronic
906114796 1:43349280-43349302 ACCGCTCTGCATCTAGTGCTGGG + Exonic
908511267 1:64851680-64851702 CCCGCTATGGAGCTACTGCAAGG + Intronic
912419868 1:109535697-109535719 CCTGCCCTACACCCAGTGCATGG - Intergenic
913233699 1:116762839-116762861 CCTGCTCTCCAGTTTGTCCAGGG - Intronic
916745856 1:167684357-167684379 CCTGCCCTGTAGCCAGAGCAAGG + Intronic
922786118 1:228283114-228283136 CCTGTCCTTCAGCCAGTGCACGG - Exonic
1063946215 10:11178793-11178815 TCAGCTCTGCGGCTAATGCAGGG - Intronic
1063961517 10:11309924-11309946 CCTGCTCTGGAGGTGGTGCAGGG + Intronic
1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG + Intergenic
1068040719 10:51820598-51820620 CCTGCTCTGAAGCCATAGCAAGG - Intronic
1068814286 10:61292253-61292275 CCAGCTCTGCAGTCAGGGCAAGG - Intergenic
1069572733 10:69504170-69504192 CCTGATCTGCTGCTAGTGGAGGG + Intronic
1070662653 10:78318625-78318647 CCTGCCTTGCAGCTAGCACATGG - Intergenic
1072896397 10:99371043-99371065 CCTGCTCTCCACCTACTGCCTGG + Intronic
1073175387 10:101553238-101553260 CCTGCTCCTCGGCTAGTCCAGGG - Exonic
1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG + Intronic
1076053878 10:127355785-127355807 CATGCTCTCCAGCCACTGCAGGG - Intronic
1076221092 10:128733749-128733771 CCCGCCCTGCAGCAGGTGCATGG - Intergenic
1076357568 10:129864232-129864254 GCTGCTCTGGGGCTGGTGCAGGG - Intronic
1076482417 10:130793187-130793209 CCTGCACTGCAGACTGTGCAGGG - Intergenic
1081856542 11:46307805-46307827 CATGCTCTGCATCTAGGGGAAGG - Exonic
1084664244 11:70567865-70567887 CCAGCCCTGCAGCTATTCCAGGG - Intronic
1085444061 11:76589134-76589156 CCTGCCCTGCAGCCACTGCCAGG - Intergenic
1086066901 11:82755154-82755176 CCAGCTCAGCAGCTAGGGGACGG - Intergenic
1086336810 11:85809307-85809329 CCTGCCCAGCTGCTAGTGCGTGG - Intronic
1086984535 11:93233681-93233703 CCTGCACTGGGGCTAGAGCAGGG - Intergenic
1088154962 11:106791324-106791346 CATGCTTTGCAGCTACTACAGGG + Intronic
1089582715 11:119491481-119491503 CATGCTCTGAAGCTAGTGGTGGG + Intergenic
1092081489 12:5720111-5720133 CCTTCTCACCAGCTAGAGCATGG + Intronic
1094833362 12:34310936-34310958 CCTTCTCAGCAGCTCCTGCACGG + Intergenic
1097151234 12:56981310-56981332 CCAGCTGTGTAGCAAGTGCAGGG + Intergenic
1098381982 12:69879279-69879301 GGTGCTCTGCAGCGGGTGCATGG - Intronic
1098731429 12:74040376-74040398 CCTGCTCCTCAGCTTGTGGACGG + Intergenic
1101355862 12:103977039-103977061 CCTGCTCAGGAACCAGTGCAAGG + Exonic
1101840745 12:108325883-108325905 CCAGTTCTGCAGAAAGTGCAAGG + Intronic
1104032885 12:125078139-125078161 CCTGCTCTGTAGCCTGGGCAGGG - Intronic
1109130910 13:58584462-58584484 CCTACACTGCAGGTATTGCATGG - Intergenic
1112032907 13:95473746-95473768 CCTGCTATGCTGCTGGTTCAGGG + Intronic
1113124812 13:106965667-106965689 CCTGGTCTCCAGCTGGTGAATGG - Intergenic
1113828624 13:113276639-113276661 CCCCTTCTGCAGCTGGTGCAAGG - Intergenic
1115941626 14:38617190-38617212 CTTGCTCTGCAGCAGGTGAAGGG + Intergenic
1117101290 14:52350953-52350975 AGTGCTATGCATCTAGTGCATGG - Intergenic
1119936684 14:78598465-78598487 CCAGCGCTGCAGCTGGTACAGGG - Intronic
1122313134 14:100809943-100809965 CCTGATCTGCAGCTGGGGCTTGG + Intergenic
1123005203 14:105318052-105318074 CCTGCTCTTCAGCAAGGGCTGGG + Intronic
1123687150 15:22806852-22806874 TCTGCCCTGCAGGAAGTGCATGG - Intronic
1123980614 15:25598835-25598857 CTTGCTCTGTAGGTAGAGCATGG - Intergenic
1124886485 15:33692204-33692226 GCTGCTCTGCTGCTGATGCACGG + Intronic
1132215640 15:100059757-100059779 CCCACTCTGCAGCTAACGCAAGG - Intronic
1132857632 16:2053992-2054014 TCTGCCCTGCACCGAGTGCAGGG + Intronic
1133166218 16:3949504-3949526 GCTGCTTGGCAGCTGGTGCAGGG - Intergenic
1133597972 16:7311216-7311238 ACTGCTCTTCAGCTAGAGCTTGG - Intronic
1134062543 16:11207843-11207865 CCTCCCTTGCAGCTAGGGCATGG + Intergenic
1137705884 16:50535632-50535654 CCTGTCCTGCACCTGGTGCATGG + Intergenic
1138352358 16:56352776-56352798 CCTGCTCTGCACCTTGGGAAGGG - Intronic
1144948606 17:18982311-18982333 CCTGCTCCCCAGCTTGTGCCTGG + Intronic
1147716898 17:42514576-42514598 CCTGAGGTGAAGCTAGTGCAGGG - Intronic
1147995664 17:44359016-44359038 CCTGCTCTGGAACTATTTCAGGG + Intronic
1148612330 17:48972543-48972565 CCAGCTCTGCAGCCAGGTCAGGG + Intergenic
1149076531 17:52602066-52602088 CCTGCTATGCAGCCTGTCCATGG + Intergenic
1149347306 17:55751388-55751410 CAAGCTCTGGAGCTAGCGCAGGG + Intronic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1152595094 17:81234038-81234060 TCTGTTCTGCAGCTTTTGCAGGG - Exonic
1155287412 18:24304888-24304910 CCTGCTCTCCACCAAGTGAATGG - Intronic
1160872428 19:1283355-1283377 CCTGGTCTGGAGCCAGTACAGGG - Intergenic
1161326923 19:3668516-3668538 TCTCCTCTGCAGCTTGTGCTGGG + Intronic
1162689170 19:12414463-12414485 CCTGCTCTGAGGCTAGGGGATGG - Intronic
1163638626 19:18449512-18449534 CCTGCTCTCCAGCCACAGCAGGG + Intronic
1163641745 19:18466053-18466075 CCTGCTCTTCAGCCAGTGACGGG + Intronic
1163795577 19:19335949-19335971 CCTGCCCTGCAGCAAGCTCAAGG + Intronic
1166041113 19:40203622-40203644 CCTGCTCATCAGCTAAAGCAGGG + Intronic
1166685189 19:44792481-44792503 CCTGCTCTGCAGCTGCTGCCTGG + Exonic
1166944844 19:46390403-46390425 CCTGCTCTGCCCCTAGCCCAGGG - Exonic
1167868970 19:52351658-52351680 CCTGCTCTGCAGCCTGTGTGAGG + Intronic
1167956549 19:53069944-53069966 CCTGAACTGCAGCTATTTCAAGG - Exonic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
926710624 2:15876677-15876699 CCTGCTCTGCATCTGTGGCATGG - Intergenic
927509046 2:23632916-23632938 CTTCCCCTGCAGCTAGGGCATGG - Intronic
928990395 2:37227050-37227072 CCTCCTGTGCACCTAGAGCATGG + Intronic
932779715 2:74552562-74552584 CCTGCTGTGCAGTTCGTGCTTGG - Exonic
933729455 2:85446082-85446104 CCAGCCCTGCAGCTGATGCAAGG + Intergenic
935492748 2:103740736-103740758 CCTGCTCTGCATCAAGCACAAGG + Intergenic
936033417 2:109089923-109089945 CATGCTCTGCTGCTAGACCAAGG + Intergenic
936110328 2:109659589-109659611 TCTGCTCAGCAGCTGCTGCAGGG - Intergenic
938568301 2:132540240-132540262 CCTGCTGTCAAGCTTGTGCAGGG - Intronic
942171134 2:173290743-173290765 CCTGCTCTGCAGCTGCTGAGTGG - Intergenic
942399057 2:175581660-175581682 CCTGCTGTGTAGCCAGGGCAAGG - Intergenic
942859975 2:180597848-180597870 CTTTCTCTACAGCTAGTGTAAGG - Intergenic
943890017 2:193275227-193275249 ACTGCTTTGCAGGTAGTGAAGGG + Intergenic
945063597 2:205929466-205929488 TCTGCTCAGCTTCTAGTGCATGG + Intergenic
947999665 2:234557459-234557481 CCTGCACTGCAGCCAGTGCTGGG - Intergenic
948670173 2:239563578-239563600 CCTGCTCTGCGTCTCCTGCACGG - Intergenic
1169046940 20:2540775-2540797 ACTGCTCTGCAGCTGCTACAAGG - Intronic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1169491396 20:6074204-6074226 CCTGCTCTGGAGCTAGGGTAAGG + Intergenic
1172742998 20:37183997-37184019 CCTGCTCTTCAACTGGTGGAAGG - Intronic
1172804611 20:37602840-37602862 CCTGCTCTGTGGTTACTGCAGGG + Intergenic
1174507833 20:51028177-51028199 CCTGCCCTGCTCCTAGTCCAGGG + Intergenic
1175335649 20:58194205-58194227 CCAGCTCTTCCGCTAGTCCAAGG - Intergenic
1175837574 20:62005969-62005991 TTTGCTCTGCAGCTAGAGAAAGG - Intronic
1176099256 20:63357519-63357541 CCTCCTCTGCAGCCAGTCCTGGG + Intronic
1176181963 20:63753686-63753708 CCTGCACAGCAGCAAGTACATGG - Intronic
1176419749 21:6504621-6504643 CCTGCTCTGGAGCCCCTGCAGGG + Intergenic
1179695242 21:43112944-43112966 CCTGCTCTGGAGCCCCTGCAGGG + Intergenic
1182151566 22:28030767-28030789 ACTGGACTGCAGCTTGTGCAGGG - Intronic
1182367910 22:29791005-29791027 CCTTCTCTGCCAATAGTGCAAGG + Intronic
1183786516 22:40032068-40032090 CCTGCACAGCAGCTTCTGCAAGG + Exonic
1184766757 22:46576448-46576470 CCTGCCCCGCAGGTAGTGCCTGG + Intronic
1184826361 22:46954582-46954604 CCTGCTCTCCACCCAGAGCATGG - Intronic
949869102 3:8571646-8571668 CCTGGTCTGCAGCTGGAGAAAGG + Intergenic
949930901 3:9077688-9077710 CCTGCCCTGCAGCCAGCACAGGG + Intronic
950101900 3:10362351-10362373 CCTCTTCTGCAGCTAGGGCTCGG + Intronic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953780853 3:45869232-45869254 CCTGCTGTGCAAGGAGTGCATGG + Intronic
954131916 3:48565196-48565218 CCCGCTCTGCAGGTAGGGCAGGG + Exonic
955900287 3:63746559-63746581 CCTTCTTTGCAGCTAGTAAAAGG + Intergenic
957534282 3:81481215-81481237 CCCGCTCTGCAGTTAGGTCAGGG + Intergenic
957809668 3:85203686-85203708 TCTGCTTTGCAGATACTGCATGG - Intronic
961634145 3:128322292-128322314 CTTGCCCTGCAGCTTGTGGAGGG + Intronic
962497183 3:135952765-135952787 CCTCCTTTGCTGCTAGGGCAGGG - Intergenic
966222212 3:177562039-177562061 CCTGCCCTGCAGCTCTTTCAGGG - Intergenic
968565468 4:1310324-1310346 TCTGCTCTACATCTAGTGGATGG - Intronic
968941898 4:3643296-3643318 CCTGCTCTGTTGCTGGGGCATGG + Intergenic
969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG + Intronic
969671150 4:8591058-8591080 CCCGCTCTGCAGCAAGTGCTGGG + Intronic
982068037 4:151671899-151671921 CCTGCTCTGCAGCGTCTCCAAGG + Intronic
984882337 4:184421080-184421102 CTTCCTCAGCATCTAGTGCAGGG - Intronic
986239846 5:5951279-5951301 CCTGCTCTGGAGTTGGTGGAGGG + Intergenic
993936750 5:94013913-94013935 ACTGCCCTGCACCTAGTACATGG + Intronic
995369458 5:111402641-111402663 CCTCCCTTGCAGCTAGGGCAAGG + Intronic
997293829 5:132757280-132757302 CCTGCTCTGCTGCTGGAGCATGG + Intronic
997887113 5:137639859-137639881 CCTGCTCTGCATCTTCTGGAAGG + Exonic
998157888 5:139796505-139796527 CCGGCTCTGCAGCTAGAGCGGGG + Intronic
999148385 5:149410784-149410806 GGTGCTCTGCAACTTGTGCATGG - Intergenic
1001425118 5:171617806-171617828 CCTGCTCTGAAGCTTGCTCAAGG + Intergenic
1001990202 5:176110351-176110373 CCTCCTCTGCAACTAGTGTGGGG - Intronic
1002226669 5:177727788-177727810 CCTCCTCTGCAACTAGTGTGGGG + Intronic
1002664424 5:180811775-180811797 CCGGCTCTGCAGCCATTGTAAGG - Intronic
1006376445 6:33674099-33674121 GCTGCTGTGCAGCCAGTGCAGGG + Intronic
1007627424 6:43254453-43254475 ACAGCTCTGCAGCTGGTGAAGGG - Intronic
1009318504 6:62255486-62255508 CCTGCTCTGCAGCTAGTGCATGG - Intronic
1012588703 6:100952825-100952847 CCTCCTCTGAAGCTAGGACAAGG + Intergenic
1013106831 6:107032892-107032914 TCTGCGCTCCAGCTGGTGCAGGG + Intronic
1015862691 6:137697273-137697295 CATGCTCTGCACCATGTGCAGGG - Intergenic
1017488654 6:154925128-154925150 CCTGCTCTGTAGCAAGGGCATGG + Intronic
1017826613 6:158086430-158086452 GCTGCTCTGCTGCCAGAGCAGGG + Intronic
1018212323 6:161494289-161494311 CCTGCTCTCCAGGTAGGTCAAGG + Intronic
1019450634 7:1095919-1095941 CCTGCTGTGCGGGAAGTGCAGGG + Intronic
1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG + Intronic
1019920383 7:4159420-4159442 TCTGCTCTGCTGGGAGTGCAGGG - Intronic
1020120723 7:5501767-5501789 CCAGCTGAGCAGCGAGTGCAAGG - Exonic
1020535473 7:9390981-9391003 CTTGCTCTGAAGCTAGAGGACGG - Intergenic
1023640430 7:42251449-42251471 CCTGCTGTGCAGCTGGAGTAGGG + Intergenic
1028309336 7:89310839-89310861 CCTGCTGTGCAGCTCCTTCATGG - Intronic
1033138125 7:138801539-138801561 CCTGCTCTGCAAATAGTTCTGGG - Intronic
1034846631 7:154452029-154452051 ACTGCTCTGGAGCTAGTGGCAGG - Intronic
1036762468 8:11518793-11518815 GCTGCTCTGCTCCAAGTGCAGGG + Intronic
1037910704 8:22742036-22742058 CCTGCCCTGGACCTAGAGCACGG - Intronic
1038493744 8:27987620-27987642 CCTTCTCTGCAGCTGTTGCAGGG - Exonic
1040954311 8:52964068-52964090 CCTGCTCTTCAGCTAATCAAGGG - Intergenic
1041584589 8:59500523-59500545 CTTGCTCTGGAGCTAGTGAAGGG - Intergenic
1043505605 8:80898887-80898909 GCTGCTCTGCACCCTGTGCAGGG + Intergenic
1044191484 8:89323912-89323934 CCTCCTCTCCATCTACTGCAGGG - Intergenic
1044409438 8:91867746-91867768 CCTGGTCTGCAGCCACAGCAGGG - Intergenic
1044703398 8:94985047-94985069 CCTCCTTTGCAGCTAGGGGATGG + Intronic
1047127386 8:121977253-121977275 CCTGCTCTGCTGGGAGGGCATGG + Intergenic
1047214560 8:122865855-122865877 CCTGCCCTGCAGCTATGCCAGGG - Intronic
1047761050 8:127954781-127954803 GCTGCTCTGCAACTGGTGCTCGG + Intergenic
1048069413 8:131005819-131005841 CTTCCTCTGCAGCTAGTCCATGG + Intronic
1049839389 8:144761359-144761381 CCTGCTCTGTAGACAGAGCAGGG + Intergenic
1049920856 9:362808-362830 CCTACTCTTCATCTGGTGCAAGG - Intronic
1049932487 9:470333-470355 CCTGCTCAGCAGCGAGTGGTTGG + Intronic
1052621178 9:30912215-30912237 CTTGCTCTTCAGCTTGTGGATGG - Intergenic
1055739981 9:79377487-79377509 CCTGCCCTGCAGCTGGGGGAGGG - Intergenic
1056852009 9:90092971-90092993 CCTCCTCTGCTGCTGGTCCATGG - Intergenic
1059770326 9:117417599-117417621 CCTCCACTGCAGCTAGAGCTTGG + Intergenic
1060031348 9:120217493-120217515 CCTGCTCTGCCCCTAGTGCCTGG + Intergenic
1060085447 9:120695884-120695906 CCTCCCCTGCAGCCAGGGCATGG + Intronic
1060194311 9:121613345-121613367 CCTCCTCACCAACTAGTGCAGGG + Intronic
1060392745 9:123291731-123291753 CCTGCTCTGCCACTTGGGCAAGG + Intergenic
1060471596 9:123952540-123952562 CCTGCAGTGCAGCTCTTGCAGGG + Intergenic
1061632278 9:131880019-131880041 CCACCTCTGCACGTAGTGCAGGG + Intronic
1061678811 9:132232561-132232583 CCTGCACTGCACAGAGTGCAGGG - Intronic
1062133730 9:134913816-134913838 CCTGCTGTGCAGCTTGAGCTTGG + Intronic
1062567189 9:137168518-137168540 CCTGCCCTGCACCTTGGGCACGG + Exonic
1186457714 X:9723042-9723064 CCTCCCTTGCAGCTAGAGCAAGG - Intergenic
1186486931 X:9940773-9940795 CCTGCTCTGTAGCTGCTTCAGGG + Intronic
1187549508 X:20287825-20287847 CCTCCCTTGCAGCTAGTGTATGG - Intergenic
1189320909 X:40086621-40086643 CCACCTCTGCAGCTCGTCCATGG + Intronic
1189926474 X:45960145-45960167 CATGCACTTCAGCTGGTGCAGGG - Intergenic
1192143256 X:68662540-68662562 TCTGCTCTCCAGCTAGACCAAGG + Intronic
1196163641 X:112514036-112514058 TCTGCTCAGCACCAAGTGCATGG + Intergenic
1198741138 X:139844413-139844435 CCTGCATTGCAGGTATTGCAGGG - Intronic
1199967899 X:152834929-152834951 CCTGCACTGGACCTTGTGCAAGG + Intronic
1200768082 Y:7097680-7097702 CCTCCCTTGCAGCTAGAGCAAGG - Intergenic