ID: 1009321311

View in Genome Browser
Species Human (GRCh38)
Location 6:62292809-62292831
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009321308_1009321311 -3 Left 1009321308 6:62292789-62292811 CCTTGAATGCATTCAGTTGGCTA No data
Right 1009321311 6:62292809-62292831 CTAGTTCAGAACCTAGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009321311 Original CRISPR CTAGTTCAGAACCTAGGTGG AGG Intergenic
No off target data available for this crispr