ID: 1009321689

View in Genome Browser
Species Human (GRCh38)
Location 6:62298282-62298304
Sequence TTATAGTTCTTGAGGTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009321689_1009321691 17 Left 1009321689 6:62298282-62298304 CCTTCTGACCTCAAGAACTATAA No data
Right 1009321691 6:62298322-62298344 GTTTTGAGCTACTAAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009321689 Original CRISPR TTATAGTTCTTGAGGTCAGA AGG (reversed) Intergenic
No off target data available for this crispr