ID: 1009325138

View in Genome Browser
Species Human (GRCh38)
Location 6:62339434-62339456
Sequence TCCAGGATGTGGGGTTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009325138_1009325144 -1 Left 1009325138 6:62339434-62339456 CCCAGAGAACCCCACATCCTGGA No data
Right 1009325144 6:62339456-62339478 AACACCTAACAAAAGAAACATGG No data
1009325138_1009325147 23 Left 1009325138 6:62339434-62339456 CCCAGAGAACCCCACATCCTGGA No data
Right 1009325147 6:62339480-62339502 TGCAGTGCTAGTGATAGAAGTGG No data
1009325138_1009325148 24 Left 1009325138 6:62339434-62339456 CCCAGAGAACCCCACATCCTGGA No data
Right 1009325148 6:62339481-62339503 GCAGTGCTAGTGATAGAAGTGGG No data
1009325138_1009325145 0 Left 1009325138 6:62339434-62339456 CCCAGAGAACCCCACATCCTGGA No data
Right 1009325145 6:62339457-62339479 ACACCTAACAAAAGAAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009325138 Original CRISPR TCCAGGATGTGGGGTTCTCT GGG (reversed) Intergenic