ID: 1009328197

View in Genome Browser
Species Human (GRCh38)
Location 6:62380444-62380466
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009328191_1009328197 29 Left 1009328191 6:62380392-62380414 CCAGGTTCTAGGAACAGGAGAAA No data
Right 1009328197 6:62380444-62380466 GGGAACAATAAGAAGAGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009328197 Original CRISPR GGGAACAATAAGAAGAGTAT GGG Intergenic
No off target data available for this crispr