ID: 1009337638

View in Genome Browser
Species Human (GRCh38)
Location 6:62512711-62512733
Sequence ATGCTGTGCCCTTCTGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009337634_1009337638 29 Left 1009337634 6:62512659-62512681 CCACTGATTTTCGAGATTCACTT No data
Right 1009337638 6:62512711-62512733 ATGCTGTGCCCTTCTGGTAGTGG No data
1009337633_1009337638 30 Left 1009337633 6:62512658-62512680 CCCACTGATTTTCGAGATTCACT No data
Right 1009337638 6:62512711-62512733 ATGCTGTGCCCTTCTGGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009337638 Original CRISPR ATGCTGTGCCCTTCTGGTAG TGG Intergenic