ID: 1009347229

View in Genome Browser
Species Human (GRCh38)
Location 6:62629063-62629085
Sequence AAGGTCATAGTGGTTGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009347229_1009347235 0 Left 1009347229 6:62629063-62629085 CCTTTCTCAACCACTATGACCTT No data
Right 1009347235 6:62629086-62629108 GGACACTATGGGCACCAGTGAGG No data
1009347229_1009347236 1 Left 1009347229 6:62629063-62629085 CCTTTCTCAACCACTATGACCTT No data
Right 1009347236 6:62629087-62629109 GACACTATGGGCACCAGTGAGGG No data
1009347229_1009347238 18 Left 1009347229 6:62629063-62629085 CCTTTCTCAACCACTATGACCTT No data
Right 1009347238 6:62629104-62629126 TGAGGGTAGCTCTAAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009347229 Original CRISPR AAGGTCATAGTGGTTGAGAA AGG (reversed) Intergenic
No off target data available for this crispr