ID: 1009347235

View in Genome Browser
Species Human (GRCh38)
Location 6:62629086-62629108
Sequence GGACACTATGGGCACCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009347229_1009347235 0 Left 1009347229 6:62629063-62629085 CCTTTCTCAACCACTATGACCTT No data
Right 1009347235 6:62629086-62629108 GGACACTATGGGCACCAGTGAGG No data
1009347231_1009347235 -10 Left 1009347231 6:62629073-62629095 CCACTATGACCTTGGACACTATG No data
Right 1009347235 6:62629086-62629108 GGACACTATGGGCACCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009347235 Original CRISPR GGACACTATGGGCACCAGTG AGG Intergenic
No off target data available for this crispr