ID: 1009351426

View in Genome Browser
Species Human (GRCh38)
Location 6:62684253-62684275
Sequence CAGTGATCAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009351418_1009351426 16 Left 1009351418 6:62684214-62684236 CCAGATCCAAAGTGGAAGTCAGT No data
Right 1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG No data
1009351421_1009351426 10 Left 1009351421 6:62684220-62684242 CCAAAGTGGAAGTCAGTGGTGGG No data
Right 1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG No data
1009351417_1009351426 20 Left 1009351417 6:62684210-62684232 CCTGCCAGATCCAAAGTGGAAGT No data
Right 1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG No data
1009351416_1009351426 21 Left 1009351416 6:62684209-62684231 CCCTGCCAGATCCAAAGTGGAAG No data
Right 1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009351426 Original CRISPR CAGTGATCAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr