ID: 1009359150

View in Genome Browser
Species Human (GRCh38)
Location 6:62792476-62792498
Sequence AACAAGTACCACTTTAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009359140_1009359150 15 Left 1009359140 6:62792438-62792460 CCACACGGGGATGCCTGCCTTGG No data
Right 1009359150 6:62792476-62792498 AACAAGTACCACTTTAATGGGGG No data
1009359144_1009359150 -9 Left 1009359144 6:62792462-62792484 CCTTCACCCTTAGCAACAAGTAC No data
Right 1009359150 6:62792476-62792498 AACAAGTACCACTTTAATGGGGG No data
1009359143_1009359150 -2 Left 1009359143 6:62792455-62792477 CCTTGGTCCTTCACCCTTAGCAA No data
Right 1009359150 6:62792476-62792498 AACAAGTACCACTTTAATGGGGG No data
1009359142_1009359150 2 Left 1009359142 6:62792451-62792473 CCTGCCTTGGTCCTTCACCCTTA 0: 465
1: 199
2: 49
3: 107
4: 236
Right 1009359150 6:62792476-62792498 AACAAGTACCACTTTAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009359150 Original CRISPR AACAAGTACCACTTTAATGG GGG Intergenic
No off target data available for this crispr