ID: 1009360999

View in Genome Browser
Species Human (GRCh38)
Location 6:62814291-62814313
Sequence CGGGCTGATGCTCCTATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009360999_1009361001 -5 Left 1009360999 6:62814291-62814313 CCTAAAATAGGAGCATCAGCCCG No data
Right 1009361001 6:62814309-62814331 GCCCGAGGTGTTCAACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009360999 Original CRISPR CGGGCTGATGCTCCTATTTT AGG (reversed) Intergenic
No off target data available for this crispr