ID: 1009366367

View in Genome Browser
Species Human (GRCh38)
Location 6:62860814-62860836
Sequence GTGGACACTCCCCGCCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009366367_1009366382 20 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366382 6:62860857-62860879 AGAGCCAGGGAGGGGGAGAGAGG No data
1009366367_1009366379 11 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366379 6:62860848-62860870 TGGATCTTAAGAGCCAGGGAGGG No data
1009366367_1009366384 22 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366384 6:62860859-62860881 AGCCAGGGAGGGGGAGAGAGGGG No data
1009366367_1009366380 12 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366380 6:62860849-62860871 GGATCTTAAGAGCCAGGGAGGGG No data
1009366367_1009366369 -9 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366369 6:62860828-62860850 AGTGTCCACCCCCTGCCAAATGG No data
1009366367_1009366381 13 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366381 6:62860850-62860872 GATCTTAAGAGCCAGGGAGGGGG No data
1009366367_1009366376 6 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366376 6:62860843-62860865 CCAAATGGATCTTAAGAGCCAGG No data
1009366367_1009366377 7 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366377 6:62860844-62860866 CAAATGGATCTTAAGAGCCAGGG No data
1009366367_1009366378 10 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366378 6:62860847-62860869 ATGGATCTTAAGAGCCAGGGAGG No data
1009366367_1009366383 21 Left 1009366367 6:62860814-62860836 CCCATATGGCGGGGAGTGTCCAC No data
Right 1009366383 6:62860858-62860880 GAGCCAGGGAGGGGGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009366367 Original CRISPR GTGGACACTCCCCGCCATAT GGG (reversed) Intergenic
No off target data available for this crispr