ID: 1009366370

View in Genome Browser
Species Human (GRCh38)
Location 6:62860833-62860855
Sequence AAGATCCATTTGGCAGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009366370_1009366386 23 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366386 6:62860879-62860901 GGGTGCTCTTACTCCTCATATGG No data
1009366370_1009366383 2 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366383 6:62860858-62860880 GAGCCAGGGAGGGGGAGAGAGGG No data
1009366370_1009366378 -9 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366378 6:62860847-62860869 ATGGATCTTAAGAGCCAGGGAGG No data
1009366370_1009366389 28 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366389 6:62860884-62860906 CTCTTACTCCTCATATGGTGGGG No data
1009366370_1009366379 -8 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366379 6:62860848-62860870 TGGATCTTAAGAGCCAGGGAGGG No data
1009366370_1009366391 30 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366391 6:62860886-62860908 CTTACTCCTCATATGGTGGGGGG No data
1009366370_1009366382 1 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366382 6:62860857-62860879 AGAGCCAGGGAGGGGGAGAGAGG No data
1009366370_1009366381 -6 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366381 6:62860850-62860872 GATCTTAAGAGCCAGGGAGGGGG No data
1009366370_1009366380 -7 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366380 6:62860849-62860871 GGATCTTAAGAGCCAGGGAGGGG No data
1009366370_1009366388 27 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366388 6:62860883-62860905 GCTCTTACTCCTCATATGGTGGG No data
1009366370_1009366384 3 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366384 6:62860859-62860881 AGCCAGGGAGGGGGAGAGAGGGG No data
1009366370_1009366390 29 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366390 6:62860885-62860907 TCTTACTCCTCATATGGTGGGGG No data
1009366370_1009366387 26 Left 1009366370 6:62860833-62860855 CCACCCCCTGCCAAATGGATCTT No data
Right 1009366387 6:62860882-62860904 TGCTCTTACTCCTCATATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009366370 Original CRISPR AAGATCCATTTGGCAGGGGG TGG (reversed) Intergenic
No off target data available for this crispr